Labshake search
Citations for Merck :
51 - 100 of 6398 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Differentiation of 4D7 and 2M12 cells was induced by 2% dimethyl sulfoxide (DMSO; Merck) for 48 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... The coverslips were rinsed with 100% methanol before being functionalised in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (5 mM; Merck), DMM (10 mM ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 2 μg/mL; Merck, Germany) for 1 h at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: 5-bromo-2-deoxyuridine (BrdU) (Merck) immunofluorescence staining was performed to assess the influence of ECM stiffness on MCF10A proliferation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Zn and Mn extraction from earthworm tissue was performed using Teflon vessels and 7 mL of reverse aqua regia (3:1 ratio of HCl:HNO3; Merck, Darmstadt) on hot plates in an open system ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...