Labshake search
Citations for Merck :
251 - 300 of 3062 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... or Cy5-conjugated secondary antibodies (1:200; AP192SA6; Merck Millipore, USA; 17 hrs at 4°C). Similar immunolabeling steps were followed for the subsequent sequential staining ...
-
bioRxiv - Genomics 2022Quote: ... the membranes were probed (overnight at 4°C) with rabbit polyclonal anti-tyrosine hydroxylase (Merck, AB152) diluted in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested DIP material was clarified (3000 × g, 10 mins and 4 °C) and sucrose (Merck, #84097) was added at a final concentration of 4 % ...
-
bioRxiv - Molecular Biology 2024Quote: ... proteins were concentrated at 3,500 rpm and 4 °C using Amicon Ultra centrifugal filter units (Merck) or using a stirred cell ultrafiltration device ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatants were subjected to end-on rotation at 4 °C with anti-FLAG (Merck, F1804) that was pre-conjugated to Protein A/G beads (Pierce ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Biochemistry 2023Quote: Total cell lysates of HEK293 cells stably expressing C-terminally Flag M2-tagged SIRT4 were incubated overnight at 4°C with anti-Flag M2 agarose beads (Merck, Darmstadt, Germany). The beads were washed three times with washing buffer (50 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...
-
bioRxiv - Cancer Biology 2024Quote: ... Only treatment naive patients that underwent anti-PD-1 monotherapy with either pembrolizumab (200 mg IV every 3 weeks or 400 mg IV every 6 weeks, Merck) or nivolumab (240 mg IV every 2 weeks or 480 mg IV every 4 weeks ...
-
bioRxiv - Biochemistry 2024Quote: ... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
bioRxiv - Developmental Biology 2022Quote: ... the channels where coated/treated with 1% (v/v) Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 (Fluorochem ...
-
bioRxiv - Bioengineering 2021Quote: ... The master was passivated by vapor deposition of perfluorosilane (1H,1H,2H,2H-perfluorooctyl-trichlorosilane, Merck kGaA). Specifically ...
-
bioRxiv - Cell Biology 2023Quote: ... Silanization was performed by applying two drops of Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Merck, 44893) onto a sheet of aluminium foil ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with the nucleus DNA stain 4′,6-diamidino-2-phenylindole (DAPI) (1μg/ml D9542-10MG, Merck Life Science UK Ltd ...
-
bioRxiv - Neuroscience 2022Quote: ... and plated in glass-coverslips (3000-4000 cells/well) pre-coated with 0.1mg/ml poly-D-lysine (2h, 37°C; Merck) and 2μg/ml laminin (over-night (O/N) ...
-
bioRxiv - Cell Biology 2022Quote: ... and seeded in 48-well plates (3000-4000 cells/well) previously coated with 0.1mg/ml poly-D-lysine (2h, 37°C; Merck) and 2μg/ml laminin (over-night (O/N) ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... then incubated overnight at 4°C with anti-KCC2 (1:200; Merck Life Sciences, Italy, #07-432) or anti-IGF-1R β (1:100 ...
-
bioRxiv - Microbiology 2021Quote: Yeast cells were digested at 90°C for 4 hours in 65% (w/v) HNO3 (Suprapur, Merck). Mineralized samples were diluted in 0.5% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... samples were incubated overnight at 4°C with primary antibodies against puromycin (1:500, MABE343, Merck Millipore), βIII tubulin (1:500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... were coated overnight at 4 °C with 2.5 µg/ml of bovine plasma fibronectin (Merck-Millipore, 341631) and collagen type I (Sigma ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The blotted membrane was incubated overnight at 4 °C with a polyclonal anti-ADAR antibody HPA051519 (Merck) diluted 1:500 with 0.1% TBST containing 5% BSA at final concentration ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were applied overnight at 4°C and included TH (Pel-Freez Biologicals #P40101 and Merck Millipore #AB9702 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gels were subsequently demulsified with 45 µl 1H,1H,2H,2H Perfluoro 1 octanol (PFO) (Merck, #370533) into 200μl of MM+ Ri medium ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... For intracellular cytokine labeling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (10μg/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Genomics 2024Quote: ... ratio by a Gibson approach with 3 h of incubation at 50°C followed by dialysis for 3 h on a membrane filter (MF-Millipore 0.025 μm membrane, Merck) and vacuum concentration ...
-
bioRxiv - Genomics 2024Quote: ... and ligated by Gibson with 3 h of incubation at 50°C followed by dialysis for 3 h on a membrane filter (MF-Millipore 0.025 μm membrane, Merck) and vacuum concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... fixated in 4% PFA (Merck), blocked for 30 min with 2% BSA (Affimetrix ...
-
bioRxiv - Neuroscience 2022Quote: ... and with 4% paraformaldehyde (Merck Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4-hydroxy-tamoxifen (Merck H7904) was solubilized in 100% ethanol ...
-
bioRxiv - Immunology 2020Quote: ... α-PanHis (H11-4, Merck Millipore), α-H2B (5HH2-2A8 ...
-
bioRxiv - Immunology 2020Quote: ... + 4 % IGEPAL CA-360 (Merck)) for timepoint 0 hrs ...