Labshake search
Citations for Merck :
51 - 100 of 3062 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... L-proline-7-amido-4-methylcoumarin hydrobromide (Pro-AMC, Merck) was used as an enzyme substrate ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Immunology 2022Quote: Murine lungs were perfused and fixed overnight at 4 °C in 4% paraformaldehyde (Merck Millipore) under agitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 °C in 10 kDa Amicon (Merck Millipore) filters ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... Fixed cells were permeabilized with 0.01% saponin (10 min, 4°C) and labeled with Phalloidin-TRITC (Merck, 30 min, 4°C). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Microbiology 2024Quote: ... After incubation for 4-7 days in anaerobic conditions using Anaerocult (Merck) at a temperature of 30 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Merck cat# D9542) was added to a final concentration of 1 μg/ml to each sample and was used to identify viable cells for analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The lysate was cleared by two centrifugations (4000 rpm, 10 min, 4 °C and 20000g, 10 min, 4°C) and filtered (Miracloth, Merck 475855-1R). The lysate (input ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lysates were centrifuged at 16,000 x g for 10 minutes at 4°C and the supernatants were then incubated overnight at 4°C with anti-Flag M2 affinity gel beads (Merck, Cat.N. A2220). M2 beads were then pelleted and washed three times with lysis buffer containing protease inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... The cortices were homogenized mechanically in PBS by pipetting up and down with a 5mL plastic pipette, centrifuged (500 x g, 7 min, 4 °C) and resuspended in DMEM (Sigma-Aldrich, Merck, Switzerland) containing 5% FCS (Biochrom ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI dihydrochloride; Merck Sigma-Aldrich), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... in pyridine (Merck Sigma, 270970). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... in pyridine (#270970, Merck KGaA) in a fume hood ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Physiology 2020Quote: ... 3.) C + 0.3 g/kg vitamin E (Merck KGaA, Darmstadt, Germany) (vit E diet) ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...