Labshake search
Citations for Merck :
201 - 250 of 3062 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated overnight at 4°C with mEM48 (1:500, Merck Millipore, Cat. # MAB5374) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated overnight at 4 °C with primary antibodies (GSX2: rabbit 1:200, Merck-Millipore ABN162 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 21,000 x g at 4°C and sterile-filtered using a 0.45µm PVDF-membrane (Merck).
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies were applied overnight at 4°C (monoclonal anti–IdU 1:4000; SAB3701448, Merck). Sections were incubated in biotinylated secondary antibodies (Jackson ImmunoResearch Labs ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 30 min at 4°C with 0.4 % paraformaldehyde (PFA, Merck KGaA) and permeabilized by washing twice with permeabilization buffer (PBS containing 2 % FBS and 0.1 % saponin (Sigma)) ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were concentrated at 3,500 rpm and 4°C using Amicon Ultra centrifugal units (Merck).
-
bioRxiv - Biochemistry 2024Quote: ... and blocked overnight at 4°C with 1% bovine serum albumin (BSA, Merck, Cat# 7906) in PBS (200 µl per well) ...
-
bioRxiv - Biophysics 2021Quote: ... Fusion was induced by surfactant replacement with 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) (PFO) ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mM MgCl2 (Merck, #7791186), 0.3% (vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cultures were treated with 4 μM of the CDK4/6 inhibitor Palbociclib/PD-0332991 (Merck, PZ-0199) for 8 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... Ovaries were washed again and incubated in DAPI (4’,6-diamidino-2-phenylindole 1 μg/mL, Merck) for 5 min at room temperature.
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Pathology 2023Quote: ... blocked with normal serum for 1 h at 22–24°C and incubated overnight at 4°C with rabbit polyclonal anti-Lubricin antibody (1:500, MABT401, MERCK, DEU). The sections were then washed three times with PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pyridine (99.8% purity, CAS-no: 110-86-1, Merck, UK) was added at concentrations between 2 - 100 mg L-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... the emulsion was destabilized by adding the surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) on top of the buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Developmental Biology 2022Quote: ... IWP2 (4 µM; Merck), XAV-939 (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% sucrose (Merck, S0389) in D-PBS for 15 min and permeabilized with 0.05% saponin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells (Loreto and Gilley ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4% PFA-fixed (Merck) and paraffin-embedded tissues were cut into 15 μm sections (IHC ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Germany)/ 4% paraformaldehyde (Merck, Germany) in 0.05 M cacodylate buffer pH 7.4) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-OHT (Merck, #H6278) was dissolved in ethanol at 1 mM and used at a final concentration of 0.5 μM in the culturing medium.
-
bioRxiv - Developmental Biology 2024Quote: ... Benzonase (Merck, 70746-4)-treated biotinylated protein samples suspended in 1 mL RIPA buffer were incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 10 minutes in 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000, Merck, Italy, D9542), to allow visualization of cell nuclei ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with following primary antibodies at 4 °C overnight: TRA-1-60 (Merck Millipore), OCT3/4 (H-134 ...
-
bioRxiv - Microbiology 2021Quote: Blocks of cells or tissue were incubated overnight in 2.3M sucrose at 4°C (Merck, K17687153) in 0.1M phosphate buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The resulting ultrafiltrate (15min 14000g 15°C) was acidified with 20 µl 4% formic acid (Merck) in dH2O ...