Labshake search
Citations for Merck :
2551 - 2600 of 5346 citations for Mouse Vacuole Membrane Protein 1 VMP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was quantified and 100ug proteins of each sample were incubated in acetonitrile with Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophilic) (#GE44152105050250, Merck) and Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were lysed in a protein extraction solution (∼10 µL/ mg tissue) consisting of 0.32M sucrose with protease inhibitors (Merck #4693159001) and phosphatase inhibitors (Pierce # A32957 ...
-
bioRxiv - Neuroscience 2024Quote: ... The eluted protein was concentrated with Amicon Ultra 15 centrifugal filters (Regenerated cellulose 10 000 NMWL; Merck Millipore, Darmstadt, Germany), aliquoted and flash-frozen on dry ice and stored at −80°C until use ...
-
bioRxiv - Biophysics 2024Quote: ... 10% v/v glycerol and 0.03% w/v DDM and 300 mM imidazole) and the eluted protein was concentrated to ∼500 μL using 100 kDa MWCO centrifugal filters (Millipore AmiconTM Ultra, Merck). The concentrated sample was then loaded onto a Superdex 200 10/300 gel filtration column (Cytiva ...
-
bioRxiv - Developmental Biology 2024Quote: ... The lysates containing 300-500 µg of protein were supplemented with 20 mM DTT and 250 units Benzonase (250 U/µl, purity grade I, Merck) and incubated at 37°C for 1h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... The lysate was cleared by centrifugation (20.000xg, 15 min, 4°C) and protein concentration was determined by Direct Detect® spectrometer (Merck). The proteasome activity was measured using a 96-well plate ...
-
bioRxiv - Developmental Biology 2024Quote: Bovine OVGP1 (bOVGP1) and murine OVGP1 (mOVGP1) recombinant proteins were purified using the Amicon Pro Purification System (Merck Millipore Ltd) by combining metal chelation chromatography with an Amicon concentrator membrane ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-Glut1 (1:100, 07-1401, Merck Millipore; and 1:400, MABS132, Sigma); anti-Fibronectin (1:600 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 1 hour with mEM48 (1:500, Merck Millipore, MAB5374) antibody at room temperature in TBS containing 0.1% TritonX-100 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Part 1 of the precursor solution contained 20 mg mL-1 fibrinogen (Merck) diluted in DMEM/F12 with HEPES ...
-
bioRxiv - Immunology 2023Quote: ... were either immersed in a 1:1 mixture of 30% hydrogen peroxide (Merck) and concentrated sulfuric acid (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Bioengineering 2023Quote: Two lipids (18:1-18:0 PC, 18:0-18:1 PC) (Merck) and stored at -20°C until sample preparation ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:500 dilution and nuclear stain DAPI (1 μg/ml, Merck, D9542) at 4°C with gentle rocking ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:2000 and/or DAPI (at 1:1000, ready-made solution, Merck).
-
bioRxiv - Developmental Biology 2023Quote: ... they were incubated in 100 μg/mL DNAse 1 (1 mg/mL, Merck) in a concentration of 1000 cells/μL for 15 mins at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... were incubated for 45 min at 4°C with 10 µL agarose beads using a RAS-GTP pull-down assay kit (RAS Activation Assay Kit, Merck Millipore, 17-218). Supernatant was recovered after centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were pre-treated with (1) 36 µl of Lysozyme [1% w/v in 1% PBS – 37°C/30min with intermittent shaking] (Merck KGaA, Germany) and then with (2 ...
-
bioRxiv - Neuroscience 2022Quote: Small and large intestines were dissected from E14 embryos and digested with 1 mg/ml DNAse 1 (AppliChem A3778) and 1 mg/ml collagenase A (Merck Millipore 10103586001) in DMEM-F12 at 37 °C while shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were incubated for 1 hour with 1% BSA blocking solution containing DAPI at 1:4,500 (Merck Life Sciences, Cat #: D9542), phalloidin at 1:350 (Merck Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned the cytoplasmic domain of AChRα (mouse; amino acid 317-428) with or without mCherry into pGEX-4T1 (Cytiva 28-9545-49; Merck). GFP-SH3BP2 with or without the intrinsic disorder domain (amino acid 164-449 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin immunoprecipitation was performed using 5-10 μg of primary mouse monoclonal ANTI-FLAG® M2 antibody (Merck, F1804-200UG) in 250 μL LB3 with 1% Triton X-100 overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the culture was stimulated by substituting one third of the medium with L929 medium (L929 mouse fibroblast cells had previously been plated in T175 cm2 cell culture flasks (Corning, Merck) with 100 mL culture medium (DMEM ...
-
bioRxiv - Cell Biology 2020Quote: ... Stag-Tulp3 was then pulled down from the TEV digestion eluates by overnight 4°C rotational incubation using S-protein agarose beads (Merck, #69704). Beads were then eluted with Laemmli buffer and processed for SDS-PAGE in Novex Value 4-20% Tris-Glycine gels (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: CAF CMed was also separated into the metabolite (less than 3kDa) and protein (more than 3kDa) fractions using 3kDa centrifugal filters (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Molecular Biology 2020Quote: ... The purity of the proteins were asses by SDS-PAGE and the fractions were pooled pure and concentrated using an Amicon Ultra concentrator (Merck Millipore) with a 10 KDa cut-off ...
-
bioRxiv - Immunology 2021Quote: ... Samples of the eluted fractions were loaded into 15% SDS-PAGE gels and the fractions containing the nucleocapsid protein were concentrated using Amicon Ultra-15 concentric filters (Merck Millipore) with a 10 kDa cutoff ...
-
bioRxiv - Cell Biology 2020Quote: ... To change the buffer in the M- and Z-AAT protein pools to Hank’s balanced salt solution (HBSS, Merck, Darmstadt, Germany) we used Vivaspin centrifugal concentrators with 10,000 MWCO (Vivaproducts ...
-
bioRxiv - Systems Biology 2022Quote: ... The proteins were washed twice with acetone and subsequently solubilized using 100 mM ammonium bicarbonate (ABC) (Merck Sigma, Cat. No. 09830). Alternatively ...
-
bioRxiv - Biochemistry 2022Quote: ... The His6- tagged proteins were purified using Immobilised Metal Affinity Chromatography (IMAC) with 2mL Ni-NTA His•Bind® Resin (Merck), followed by incubation with TEV protease for 12 hours at 4 °C to remove the His6 tag ...
-
bioRxiv - Microbiology 2020Quote: ... The collected supernatant was kept on ice until measurements of protein concentrations using Direct Detect® Spectrometer (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2020Quote: ... were expressed as fusion proteins with 6x polyHis tail at the C-terminus in E.coli strain BL21(DE3) (Merck-Novagen, Darmstadt). After harvesting ...