Labshake search
Citations for Merck :
151 - 200 of 905 citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... and one half was treated with 50 µg/ml proteinase K (Merck, Darmstadt, Germany) to remove all non-imported preproteins ...
-
bioRxiv - Cell Biology 2021Quote: ... After blocking for one hour in PBST with 5% normal goat serum (Merck G9023) and 0.1% BSA ...
-
bioRxiv - Physiology 2020Quote: ... separated on SDS polyacrylamide gel (12%) and transferred to a PVDF membrane (Merck). After 1 h blocking (Odyssey blocking buffer with 0.1% Tween20) ...
-
bioRxiv - Biophysics 2020Quote: ... A549 cells were cultured in DMEM/F-12 medium (Merck KGaA, Darmstadt, Germany). Cells were seeded in LabTek II chamber slides (NUNC ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg/mL phorbol 12-myristate 13-acetate (PMA) and Ionomycin (Merck) to corresponding positive control wells ...
-
bioRxiv - Cancer Biology 2019Quote: ... 72 hrs or 7 days after adding the drugs organoids were fixed with 4% PFA (Merck) and stained with Hoechst (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: 7 weeks old mice were injected intraperitoneally with 10 mg/kg body weight Azoxymethane (AOM, Merck), dissolved in isotonic saline solution ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Immunology 2023Quote: ... and perfringens Types C and D (Vision 7 with SPUR, Merck Animal Health; Madison, NJ, USA). The cattle were also treated with fenbendazole (SafeGuard ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Physiology 2023Quote: ... Embryos were dehydrated in one hour intervals in an ascending tetrahydrofuran (THF, Merck, Darmstadt, Germany) series (50% THF ...
-
bioRxiv - Systems Biology 2020Quote: RPE maintenance medium: 29% Nutrient Mixture F-12 (#N6658, Merck & Co., Inc., NJ, USA), 1.9 mM L-Glutamine (#G7513 ...
-
bioRxiv - Microbiology 2019Quote: ... Cell density was measured every 12 h using a Scepter Automated Cell Counter (Merck). Replication time was calculated as
-
bioRxiv - Developmental Biology 2023Quote: ... NuPage 4 to 12% bis-tris protein gels (NP0323, Thermo Scientific; or MP42G15; Merck) before transferring into 0.22μm pore size polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2023Quote: ... Macrophages were differentiated with 200 nM phorbol 12-myristate 13-acetate (PMA) (Merck KGaA) following a previously described method with slight modifications [52] ...
-
bioRxiv - Neuroscience 2024Quote: 12 x 106 HEK293T cells were seeded in 150 cm2 Corning flasks (#CLS431465, Merck) and cultured overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...