Labshake search
Citations for Merck :
1751 - 1800 of 1874 citations for 5 FLUORO 2 MERCAPTOBENZOTHIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM TCEP) and concentrated to approximately 5 ml using an Amicon® Ultra Centrifugal Filter Ultracel®-3K (UFC900324, Merck/Millipore, Darmstadt, Germany) before loading onto a HiTrap™-Heparin HP column (Cytiva ...
-
bioRxiv - Microbiology 2020Quote: ... spores were collected from 5-day-old cultures NO3 medium (0.17% yeast nitrogen base, 3% sucrose, 100mM KNO3) by filtering through miracloth (Merck; pore size of 22–25μm). Spores were centrifuged ...
-
bioRxiv - Immunology 2020Quote: Following protein digestion a 5% volume of the peptide solution was cleaned up with a reverse phase (C18) ZipTip (Merck Millipore, Burlington, MA, USA). The peptide sample was acidified with the addition of 1 μl 1M hydrochloric acid ...
-
bioRxiv - Immunology 2022Quote: ... Tissue samples for RNA-protein extraction were cut into small pieces (< 5 mm) and placed in a microcentrifuge tube containing RNAlater® solution (Merck Ltd, Dorset, UK) and stored at −70°C until further use.
-
bioRxiv - Plant Biology 2022Quote: ... Spore concentration was counted via haemocytometer and adjusted to 1 x 105 spores per mL in 0.1% gelatin or dH2O with 0.01% Tween 20 (Merck Chemicals, CAS Number: 9005-64-5).
-
bioRxiv - Neuroscience 2024Quote: ... each sample was separated on 5-20% gradient e-PAGEL mini gels (ATTO Corporation, Tokyo, Japan) and transferred to polyvinylidene fluoride membranes (Merck Millipore, Billerica, MA, USA). The membranes were incubated for 30 min with blocking buffer (Nacalai Tesque) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: HPLC separations were performed on a Waters 2695 separations module equipped with a Waters 2996 photodiode array detector and HPLC analysis was carried out using a LiChrospher® 100 RP-18 column (4 mm × 250 mm, 5 μm) (Merck, Kenilworth, NJ, USA). The mobile phase consisted of two solvent reservoirs ...
-
bioRxiv - Developmental Biology 2022Quote: ... MII oocytes were activated for 6 h in Ca-free α-MEM medium containing 10 mM SrCl2 and 5 μM Latrunculin B (cat. no. 428020, Merck Millipore, Darmstadt, Germany). Following activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:1000) and vinculin loading control (Cell signalling #4650, diluted 1:1000) in 5% bovine serum albumin (BSA) (Merck, Kenilworth, NJ, United States)/TBS-Tween overnight at 4° C ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were allowed to adhere overnight (16 h) in the presence of 2 mM Thymidine (S-phase block; Merck, Darmstadt, Germany) and released into fresh medium ...
-
bioRxiv - Microbiology 2019Quote: ... Under these conditions nitrite was not detectable with a colorimetric test with a lower detection limit of 2 mg/L (MQuant test stripes, Merck, Darmstadt, Germany). Growth conditions and operation of the bioreactor containing ANME-2d archaea enriched from an Italian paddy field soil are described by Vaksmaa et al. ...
-
bioRxiv - Neuroscience 2021Quote: TEER across cellular monolayers was measured with chopstick electrodes in 24-well Transwell inserts using the Millicell® ERS-2 Voltohmmeter (Merck Millipore). The absolute TEER of eGFP-hCldn5-MDCK II cells before treatment was recorded as a baseline reading ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Biochemistry 2021Quote: ... After adding 1 drop of bovine thrombin (Biomed, Lublin, Poland) to 2 drops of fibrinogen (1mg/ml; Sigma-Aldrich, St. Louis, MO; Merck KGaA) the cells were entrapped within the fibrin clots ...
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Cell Biology 2021Quote: ... ethanol and cut into 1–2 mm3 pieces and was cultured in Dulbecco’s modified Eagle medium (DMEM) (Sigma-Aldrich, Merck, Darmstadt, Germany) with 10% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Plant Biology 2021Quote: ... 1000 μl tips were fitted with 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 10 μg of LiChroprep® RP-18 peptides (Merck). Tips were sequentially equilibrated with 100 % methanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Neuroscience 2020Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Biochemistry 2021Quote: ... The total extract of proteins was then centrifuged for 20 min at 20,000 g and the soluble fraction loaded on an affinity chromatography with 2 ml of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). The resin was washed with 20 ml of 20 mmol/L Tris-HCl (pH7.9 ...
-
bioRxiv - Cell Biology 2020Quote: ... All surrounding agarose was removed from the tissue and 2-3 tissue slices were positioned on each Millicell Cell Culture Insert (Merck Millipore, PICM0RG50) using No.22 scalpels (Swann-Morton ...
-
bioRxiv - Biophysics 2020Quote: Upon deposition the samples were washed 2 times 15 minutes with PBS prior to overnight fixation with 4% paraformaldehyde (PFA, Merck, Darmstadt, Germany). Washing steps and incubation took place under agitation at 4 °C unless stated otherwise ...