Labshake search
Citations for Merck :
101 - 150 of 3048 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 5 mM CaCl2 (Merck), and 20 U/mL DNase I (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 mM CaCl2 (Merck), and 20 U/mL DNase I (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM NaHCO3 (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Physiology 2024Quote: ... 5 mM EDTA (Merck), 50 mM Tris pH 8 (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM EDTA (Merck), 0.1 % w/v SDS (Roth) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (Merck), 1× cOmplete Mini ...
-
bioRxiv - Immunology 2024Quote: ... 5% Donkey Serum (Merck) in 0.01% PBS-Tween-20 (PBST) ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM dichloroacetate (Merck), 100 nM mocetinostat (Biomol) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µL Benzonase (Merck) and a spatula tip of lysozyme (Merck ...
-
bioRxiv - Biophysics 2024Quote: ... 5 mM BTFA (Merck) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Biophysics 2024Quote: Glass coverslips (Paul Marienfeld GmbH, 24 x 50 mm, 170 ± 5 μm) were overnight incubated in 100 mM Sulphuric acid (Merck). Afterwards the coverslips were rinsed consecutively with Milli-Q water ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM protocatechuic acid (cat. no. 03930590, Merck) and 0.1 μM protocatechuate 3,4-dioxygenase (cat ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 µl pure trifluoroacetic acid (TFA, Merck). In samples destined for 4-ONE analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated the slides for 5 min in fresh 5% GIEMSA solution (1.09203, Merck) diluted in 100 ml Gurr buffer (10582-013 ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 μM rosiglitazone (Merck). After 21 days of exposure to the adipogenic medium ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% CO2 in KSOM (Merck) until transplantation ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5% ChemiBLOCKER (Merck Millipore) in 0.1 M NaP ...
-
bioRxiv - Microbiology 2022Quote: ... 5 gr/L (Merck, Germany); (NH4)2HPO4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% Penicillin-Streptomycin (Merck, P0781), 1% Amphotericin B (Merck ...
-
bioRxiv - Pathology 2022Quote: ... 5 mM MgCl2(hexahydrate) (Merck), 10 % v/v glycerol (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% ChemiBLOCKER (Merck Millipore) in 0.1 M NaP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 nM RTV (Merck). BrMφ media (DMEM (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/mL insulin (Merck) and 5 μM rosiglitazone (Merck) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 g/l NaCl (Merck), 1 g/l K2HPO4-trihydrate (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5% penicillin/streptomycin (Merck). Cells were split at 80% confluence using trypsin-ethylenediaminetetraacetic acid (trypsin EDTA ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 5 mM EDTA (Merck), supplemented with 5% foetal calf serum (FCS ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM MgCl2 (Merck) (Striepen and Soldati ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg/ml hydrocortisone (Merck) and 1% penicillin streptomycin mix (Fisher scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM EDTA (Merck, USA), 10 mM Tris-HCl pH 8.0 (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM phosphocreatine (Merck, P7936), 7 U/ml creatine phosphokinase (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg/ml insulin (Merck), 1% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM MgCl2(6H2O) (Merck), 10 % v/v glycerol (Sigma) ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM MgCl2 (hexahydrate) (Merck), 10 % v/v glycerol (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% ý-mercaptoethanol (Merck). Subcellular fractionation of cytoplasmic ...