Labshake search
Citations for Merck :
51 - 100 of 3048 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... + 5% HS + 5% donkey serum (DS, Merck - D9663) at RT for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Microbiology 2021Quote: ... The samples were deproteinized by addition of 10 μL of cold 5-sulphosalicilic acid (SSA, Merck) (300 mg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Immunology 2021Quote: ... pH 5 (0.1 M citric acid monohydrate from Sigma and 0.2 M disodium phosphate dihydrate from Merck)) was added to the plate and incubated for 30 minutes in the dark ...
-
bioRxiv - Plant Biology 2023Quote: Exogenous hormone treatments comprised 5 μM 1-napthaleneacetic acid (NAA; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Cell Biology 2023Quote: ... The sections were treated with 0.5% Periodic acid for 5 min and stained in Schiff’s reagent (Merck) for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore) for 30 mins at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µM retinoic acid (R2625, Merck) was added ...
-
bioRxiv - Plant Biology 2022Quote: ... 13C5-5-MTHF and 13C5-5-FTHF were purchased from Merck Eprova (Schaffhausen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v) (Merck, Roth) in a developing chamber (CAMAG ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Neuroscience 2020Quote: 2-phospho-Ascorbic Acid (Merck Sigma, #49752)
-
bioRxiv - Biochemistry 2021Quote: ... 5 µL Benzonase (Merck) was added and the cells lysed by passing the suspension at least twice through a Microfluidiser (Microfluidics) ...
-
bioRxiv - Pathology 2022Quote: ... 5 mM EDTA (Merck), 0.1 % w/v SDS (Carl Roth) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM ATP (MERCK, Sigma Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 5% Donkey Serum (Merck) in 0.01% PBS-Tween-20 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM H2SO4 (Merck) was used at a flow rate of 0.6 mL/min ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM EDTA (Merck), 50 mM Tris pH 8 (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... Keratin 5 (#HPA059479, Merck) and Tubulin beta 4 (#T7941 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% mercuric chloride (Merck) and 5% potassium chromate (Merck ...
-
The membrane-cytoplasmic linker defines activity of FtsH proteases in Pseudomonas aeruginosa clone CbioRxiv - Biochemistry 2023Quote: ... 5 µL Benzonase (Merck) and EDTA-free protease inhibitor for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA (Merck), 50 mM Tris pH 8 (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% ChemiBLOCKER (Merck Millipore) in 0.1 M NaP ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL Benzonase (Merck) was added and the suspension was stirred thoroughly ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-FU (Merck F6627), Oxaliplatin (Merck O9512) ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM EDTA (Merck), 1 % v/v IGEPAL® CA-630 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... mitoTEMPO (5 μM; Merck), or rapamycin (10 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM EDTA (Merck), 0.1 % w/v SDS (Roth) ...