Labshake search
Citations for Merck :
201 - 250 of 3048 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/ml Insulin (Merck I2643), and 10% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 mM Trolox (Merck, 238813); also ...
-
bioRxiv - Microbiology 2024Quote: ... 5 g/L yeast extract (Merck Life Science Pty Ltd ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM lithium chloride (Merck, Germany) and 1 µM ketamine (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... proteins were subsequently alkylated with 20 mM Indole-3-acetic acid (Merck) for 1h at room temperature in the dark and diluted to 2M Urea ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Molecular Biology 2024Quote: ... STEMdiff Forebrain Neuron Maturation medium was supplemented for 6 days with 5 µM 5-fluorouracil/uridine (Merck) to stop growth of non-differentiated cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 μl of cell suspension was collected and mixed with 200 μl of ice-cold HBSS containing 5% fatty acid-free bovine serum albumin (BSA, Merck Millipore, 126575-10GM). To quench the fluorescence of non-internalized NBD-phospholipids ...
-
bioRxiv - Genetics 2022Quote: ... 5 µg SA8 was dissolved in 10 µL 10 mM hydrochloric acid and digested with 20 ng/µL pepsin (Merck, cat. No. 10108057001) at 37 °C for 6 h ...
-
bioRxiv - Bioengineering 2022Quote: ... in Cytoskeleton Buffer (CB, 10 mM 4-Morpholineethanesulfonic acid,2-(N-Morpholino)ethanesulfonic acid (MES #M3671, Merck), 138 mM KCl (#6781 ...
-
bioRxiv - Microbiology 2020Quote: ... 2-Propanol and hydrochloric acid (HCl) were purchased from Merck, India ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-cysteine sulfenic acid 2-thiodimedone (ABS30, Merck, Darmstadt, Germany), living colors mouse anti-GFP (632681 ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.1% 2-(N-morpholino)ethanesulfonic acid (Merck Millipore, Burlington, MA), and 0.8% agar (BD Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Cancer Biology 2021Quote: ... were injected onto a Sequant ZIC-pHILC column (150 mm × 2.1 mm, 5 µm) and guard column (20 mm × 2.1 mm, 5 µm) from Merck Millipore kept at 45°C ...
-
bioRxiv - Systems Biology 2020Quote: ... which includes 5% of PBS buffer and 5% acetonitrile in 0.15 M sodium chloride solution (Merck, Darmstadt, Germany). The pH of equilibration buffer was 7.2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Metabolites were separated using a Sequant ZIC-pHILIC column (2.1 x 150 mm, 5 μm, guard column 2.1 x 20 mm, 5 μm; Merck) with elution buffers acetonitrile (A ...
-
bioRxiv - Bioengineering 2020Quote: ... Following PBS washes (5 min x3) and overnight incubation in blocking buffer (5% bovine serum albumin (Merck Millipore) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Metabolites were separated using a Sequant ZIC-pHILIC column (2.1 cm × 150 mm, 5 μm, guard column 2.1 cm × 20 mm, 5 μm; Merck) with elution buffers A (acetonitrile ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Microbiology 2022Quote: ... 5°6.7’ E) in September and October 2017 by filtering 2 L of seawater through PVDF membrane filters (Merck Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated lipids were dissolved in 30 μL of chloroform:methanol (2:1, v/v) and 5 μL loaded on thin-layer chromatography (TLC) silica gel plates F254 (Merck). Lipids were separated in chloroform/methanol/water (20:4:0.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... they were washed 3 times with 1X PBS for 5 minutes and incubated with DAPI (4’6-Diamidino-2-phenylindole; 1 µg/mL, MERCK) for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were reduced utilizing a 5 mM solution of tris-2-carboxyethyl-phosphine (TCEP) (Merck KGaA, Darmstadt, Germany) at a temperature of 60 °C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whose composition is as plating media but with 5% FBS and 2 μM cytosine β-d-arabinofuranoside (Merck, C6645) to limit glial growth ...
-
Inositol depletion regulates phospholipid metabolism and activates stress signaling in HEK293T cellsbioRxiv - Cell Biology 2022Quote: ... 5 μm particle diameter (Merck, Darmstadt, Germany) and a “reverse phase column” Acquity UPLC HSS T3 ...
-
bioRxiv - Bioengineering 2020Quote: ... 5 μM Pro-survival Compound (Merck Millipore) was added only on the day of splitting ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM N-acetylcysteine (NAC) (106425, Merck) complete cell culture medium or control medium ...
-
bioRxiv - Cell Biology 2021Quote: ... or 5 µM STLC (Merck Life Science) for 16 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% CO2 in high-glucose DMEM (Merck) supplemented with 10% FBS (ThermoFisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... and 5% sucrose (Merck Millipore, New Zealand). To select for Psa strains carrying pBBR1MCS-5B vectors for effector complementation ...
-
bioRxiv - Physiology 2022Quote: ... 5 mg/kg dasatinib (SML2589-50MG; Merck) and 50 mg/kg quercetin (Q4951-10G ...