Labshake search
Citations for Merck :
1151 - 1200 of 2466 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Microbiology 2024Quote: ... (Loba Chemie, India), nickel (Nickel Chloride Hexahydrate, NiCl2.6H2O) (Loba Chemie, India), and lead (Lead Nitrate, Pb(NO3)2) (Merck Chemicals, India) at a concentration of 100µg/mL ...
-
bioRxiv - Immunology 2024Quote: ... and EV- containing fractions were pooled and concentrated to 2 ml with 10 kDa molecular weight cut-off Amicon centrifugal filter units (Merck Millipore). For the proteomic analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mM MgCl2 (optimal ATP to MgCl2 ratio), 0.2 mM NADH, 2 mM PEP, 8 U PK (rabbit muscle, (Merck, Darmstadt, Germany)) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and then the salts of PBS were removed using the Amicon Ultra-2 centrifugal filter units from Merck (New Jersey, USA). The sample was added on a formvar-coated carbon grid ...
-
bioRxiv - Biochemistry 2024Quote: ... 18 µL of a 20 µM solution of LmPDTN56C was mixed with 2 µL 100x SYPRO Orange (Merck kGaA, Darmstadt, Germany). The samples were then subjected to a temperature ramp spanning from 35 to 95 °C at 1 °C/min recording the fluorescent emission (Exc ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells per mL were suspended in 1 mL of a 1.2% sodium alginate solution (Merck, Saint-Quentin-Fallavier, France). Beads were formed by dripping the cell suspension into a sterile 100 mM CaCl₂ solution (VWR ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were analyzed by SDS-PAGE and those containing h15-LOX-2 were pooled and concentrated with an Amicon Ultra Centrifugal Filter (30 kDa cutoff) (Merck, Germany). Finally ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were picked from a single colony and grown overnight in -Ura synthetic minimal media (2 g/L Yeast Synthetic Drop-out Medium Supplement without uracil (Merck #1501), 67 g/L Yeast Nitrogen Base Without Amino Acids (Merck #Y0626) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore) for 30 mins at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: 2.0E6 HeLa cells were resuspended in trifluoroacetic acid (TFA) (Merck) in a sample to TFA ratio of 1:4 (v/v) ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were obtained from Novabiochem (Merck KGaA, Darmstadt, Germany). Peptides were purified using reverse phase preparative high-performance liquid chromatography (HPLC ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction was terminated by adding trifluoroacetic acid (TFA, Merck) to a final concentration of 1% resulting in a final pH of 2 ...
-
bioRxiv - Biophysics 2020Quote: ... Acetonitrile and formic acid were purchased from Merck (Darmstadt, Germany). All chemicals and reagents were of appropriate analytical grades.
-
bioRxiv - Immunology 2020Quote: ... Amino acids were purchased from Novabiochem (Merck KGaA, Darmstadt, Germany). N ...
-
bioRxiv - Biochemistry 2022Quote: Suberic acid bis(N-hydroxysuccinimide ester) (DSS) cross-linker (Merck) was added 1:1 (w/w ...
-
bioRxiv - Biochemistry 2022Quote: ... containing 0.1% V/V formic acid (Sigma Aldrich; Merck KGaA).
-
bioRxiv - Cell Biology 2022Quote: ... the reaction was stopped by adding 1% formic acid (Merck), pH < 3 ...
-
bioRxiv - Microbiology 2022Quote: ... at 1 mg/mL in 63% of lactic acid (Merck), and from this stock we made a 1/30 dilution in distilled water (33 µg/mL in 2.1% of lactic acid) ...
-
bioRxiv - Immunology 2022Quote: Peptide samples were acidified by adding 1 % trifluoroacetic acid (Merck) and debris pelleted by centrifugation for 5 minutes at 14 000 × g ...
-
bioRxiv - Neuroscience 2022Quote: ... The loading buffer used was 0.1% trifluoroacetic acid (Merck Millipore)–water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Reaction was stopped with 2N sulphuric acid (Merck; Darmstadt, Germany) and the optical density was read at 490 nm using the Multiskan microplate spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... dichlormethane (≥99 %) and acetic acid (≥99 %) were purchased from Merck. Acetic anhydride (99% ...