Labshake search
Citations for Merck :
1101 - 1150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and as secondary antibody goat anti-mouse polyclonal antibody conjugated with horse radish peroxidase (HRP) from Merck Millipore was used at a dilution of 1:3500 ...
-
bioRxiv - Microbiology 2024Quote: ... peptides were filtered through centrifugal filter units (Merck, PVDF, 0.22 µm) before being transferred to MS vials.
-
bioRxiv - Microbiology 2024Quote: ... Plates were sealed with transparent breathable membranes (Breathe-Easy®, Sigma-Aldrich-Merck) and incubated at 37 °C in a Cytomat 2 incubator (Thermo Scientific ...
-
FlhE functions as a chaperone to prevent formation of periplasmic flagella in Gram-negative bacteriabioRxiv - Microbiology 2024Quote: CellASIC ONIX Microfluidic Platform and CellAsic Onix plates B04A (Merck) were used for live-cell observations ...
-
bioRxiv - Microbiology 2024Quote: ... and Indium at 10 mg L−1 (Merck, Darmstadt, Germany) were used as internal standards ...
-
bioRxiv - Immunology 2024Quote: ... The ethanol and unloaded nucleic acids in the mixtures were removed using Amicon Ultra centrifugal filters (10- or 30-kD MWCO, Merck) for two rounds with 5- and 15-times volumes of 1× PBS ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Microbiology 2024Quote: ... The parasite solution was passed through a filter of 3 μm exclusion size (Merck-Millipore, TSTP04700) to remove host cell debris and collected in 15 ml conical tubes ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated o/n at 4°C in 10 ml washing buffer (1% [w/v] milk powder in TBS-T) containing a 1:10,000 dilution of anti-pan-ADP-ribose binding reagent MABE1016 (Merck) at 4°C48 ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total protein was extracted using RIPA buffer mixed with protease inhibitor cocktail (Millipore Merck, 539134) and quantified using Qubit® Protein Assay Kit (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the RDF plasmid encoding the RD114 envelope) using the GeneJuice transfection reagent (Merck Millipore). Viral supernatant was collected 48 and 72 hours after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... the mycelium of each sample was transferred into a Miracloth filter (#475855-1R, Merck Millipore, Brulington, MA, USA) fitted in a funnel and washed three times with medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... Coverslips were permeabilised for 25 minutes in PBS containing 0.1% Triton-×100 (Merck, UK), blocked in PBS containing 10% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... blocked in PBS containing 10% (v/v) BSA + 0.1% (v/v) Triton-×100 (both Merck, UK) and primary antibodies (γH2AX ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10mM Nicotinamide (Sigma/Merck, N0636-100G), 1.25mM N-acetyl-L-cystine (Sigma/Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... or DMSO (Merck #D2650), as a vehicle control ...
-
bioRxiv - Microbiology 2024Quote: ... cerevisiae strains was investigated in SC -Ura medium supplemented with 1.5 ppm prothioconazole dissolved in 50 % DMSO (Merck, NJ) and measuring the OD600 in SpectraMax Gemini™ XPS/EM microplate reader (Molecular Devices ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2LJμg/mL polymyxin B (Merck). Following staining ...
-
bioRxiv - Microbiology 2024Quote: ... Harris hematoxylin and eosin were obtained from Merck. SSG is a kind gift from Albert David ...
-
bioRxiv - Microbiology 2024Quote: A 40% stock PEG 3350 (Merck, 202444) solutions (w/v ...
-
bioRxiv - Microbiology 2024Quote: ... standard dilution or sample was added into the wells of a 96-well clear bottom plate and 250 μL of Bradford reagent (Merck, Darmstadt, Germany) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... was conjugated to magnetic beads (Sera-Mag, Merck, cat# GE17152104010150) for 2 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Lipids were visualised with thin layer chromatography (TLC) by adding 20 μL of sample on a silica gel 60 F254 sheet (Merck) and placed in a chloroform/methanol/water (90:10:1 ...
-
bioRxiv - Microbiology 2024Quote: ... for 10 minutes in the dark and then filtered through Nuclepore black polycarbonate membrane filters (0.22 µm pore size, Merck Millipore, Darmstadt, Germany) with negative pressure (≤ 20 kPa) ...
-
bioRxiv - Molecular Biology 2024Quote: ... with 0.2% Tween20 and 0.1 mg/mL proteinase K (Merck, Darmstadt, Germany) in Super-Q water was added to the microfuge tubes with samples [32] ...
-
bioRxiv - Molecular Biology 2024Quote: 300 µL 0.5% digest buffer (10 mM Tris-HCl pH 7.5, 10 mM EDTA pH 8.5, 50 mM NaCl (Merck) and 0.5% sodium dodecyl sulfate ...
-
bioRxiv - Molecular Biology 2024Quote: ... then transferred to a Phase Lock Gel (PLG) tube (QuantaBio, Beverly, MA, USA) containing 0.5 mL phenol:chloroform:isoamyl alcohol (25:24:1) buffer (Merck). After thorough vortexing ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 µL proteinase K (10 mg/mL) and 8 µL of 1 M DTT (Merck) was added to the sperm fraction which were vortexed and incubated at 56 °C for 60 min (mock casework samples ...
-
bioRxiv - Molecular Biology 2024Quote: We used human APOL1 gene locus transgenic mice (BAC/APOL1 mice)17,45 with APOL1-G0 and APOL1-G1 heterozygotes (Merck & Co., Inc. (Rahway, NJ, USA)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% sodium deoxycholate (v/v)] with 1X EDTA free Protease inhibitor cocktail (Merck cat #: 04693159001) and with or without 1X phosphatase inhibitor (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... anti-calnexin (Merck, MAB3126), anti-HA (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... 15 µg of total protein in a volume of 47 µl 1x sample buffer was treated with 7 U of benzonase (#70746; Merck Millipore, Burlington, MA, USA) in dilution buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Microbiology 2024Quote: ... all solid reagents were from Merck-Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... using a Guava easyCyte Flow Cytometer (Merck-Millipore) and analyzed by FlowJo software (FlowJo LLC).
-
bioRxiv - Microbiology 2024Quote: ... MLLEPab1 were inserted into the pET22 vector (Merck 69744) with a hexa-histidine tag at the N-terminus (Fig ...
-
bioRxiv - Microbiology 2024Quote: ... Additionally, sequences encoding MLLE3 variants (wildtype, and mutations, SI Tables S11– S12) were inserted into the pGEX-2T vector (Merck GE28-9546-53) with Glutathione S-Transferase (GST ...
-
bioRxiv - Microbiology 2024Quote: ... 10 mM EDTA and finally once with LC-MS grade water (Merck, Germany). After washing ...
-
bioRxiv - Microbiology 2024Quote: ... G3PDH activity was determined as glycerol-3-phosphate (G3P) (Merck, Germany) dependent reduction of DCIPIP at 600 nm (extinction coefficient 20.7 mM-1 cm-1 ...
-
bioRxiv - Microbiology 2024Quote: ... and lactate dehydrogenase (LDH) (Merck, Germany) at 340 nm (42°C ...
-
bioRxiv - Microbiology 2024Quote: ... concentrated up to 5 ml using Amicon Ultra-15 centrifugal filter unit (Merck Millipore) and loaded on a HiLoad 16/600 Superdex 200 gel filtration column (Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... the sample was filtered in an Amicon Ultra-0.5 Centrifugal Filter Unit 10 kDa (Merck Millipore cat # UFC501096) supplemented with a 100 µl of 0.1 M Na phosphate buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... The LC separation was done using the SeQuant ZIC-pHILIC (150 mm × 2.1 mm) with the SeQuant guard column (20 mm × 2.1 mm) (Merck). The mobile phase B was acetonitrile and the mobile phase A was 20 mM ammonium carbonate with 0.1% ammonia hydroxide in a 80:20 solution (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... and cell debris was removed by passing it through a 0.45 μm pore size filter (Merck, Cat# SLGVR33RB). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: Mock or SINV WT-infected cells were plated on 8 wells LabTek slide (Merck Millipore), were fixed with 4% formaldehyde (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Microbiology 2024Quote: ... 500µg of cell lysates were incubated with pre-washed EZview Red ANTI-HA or FlagM2 affinity Gel Beads (E6779 and F2426, Merck) at 4 °C under overnight rotation ...
-
bioRxiv - Microbiology 2024Quote: ... then filtrated trough sterile Miracloth (Merck Millipore) and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...