Labshake search
Citations for Merck :
1001 - 1050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... the cells were transiently transfected with Cx26 constructs tagged at the C-terminus with a fluorescent marker (mCherry) according to the GeneJuice Transfection Reagent protocol (Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... transferred to Microcon-30kDa Centrifugal Filter Units (MRCF0R030, Merck) and washed several times with 8 M urea and once with digestion buffer (DB ...
-
bioRxiv - Biochemistry 2024Quote: ... ROS quenching was carried out by treating cells with 5 mM N-acetyl cysteine (NAC) (616-91-1, Merck) for 1 h.
-
bioRxiv - Microbiology 2024Quote: Pyronin-Y (Merck) is a strong red-colored fluorescent compound ...
-
bioRxiv - Plant Biology 2024Quote: ... 2% Triton X-100) supplemented with 1x plant protease inhibitor (Merck). Cell debris was removed by several centrifugation steps at 8,000 x g for 10 min at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... Incubation was performed with anti-polyQ [1:1000] (Merck, MAB1574). The membrane was washed 3 times for 5 min and incubated with secondary antibodies in TBST 3% BSA for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated with the following antibodies: mouse monoclonal raised against eIF5A1 (SAB1402762, Merck), rabbit polyclonal raised against eIF5A2 (17069-1-AP ...
-
bioRxiv - Pathology 2024Quote: ... 12,000 cells per well were seeded into MCDB media (Merck, Singapore) using an XF96 well plate (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit polyclonal anti-hypusine (ABS1064-I, Merck).
-
bioRxiv - Neuroscience 2024Quote: ... after which they were incubated in primary antibody (mouse anti-MBP 1:500, Merck NE1019 ...
-
bioRxiv - Genomics 2024Quote: ... Swinnex filter holders (Merck KGaA, Germany), and forceps on every occasion of water collection from the vent ...
-
bioRxiv - Genomics 2024Quote: ... 500 mL vent-water was passed through a sterile 0.22 μm mixed cellulose ester membrane filter (Merck Life Science Private Limited, India) having a diameter of 47 mm ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli were determined by dilution plating on LB + 0.5 % agar and LB + 0.5 % agar with Kanamycin (40 μg / mL) (Merck Germany).
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli were determined by dilution plating on LB + 0.5 % agar and LB+0.5% agar with Kanamycin (40 μg/mL) (Merck Germany).
-
bioRxiv - Cell Biology 2024Quote: 1H4/pSR (Merck MABE50), B23/NPM1 (Sigma B0556) ...
-
bioRxiv - Neuroscience 2024Quote: ... the probe was coated with DiI (1 mM in ethanol, Merck, #42364) for later histological confirmation of the recording site and a wire was connected to the ground pin for both an external reference and ground ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Culture aliquots were vacuum-filtered on a 0.45 μm pore size filter (HVLP02500, Merck Millipore). Filters were immediately transferred into a 40:40:20 (v-% ...
-
bioRxiv - Plant Biology 2024Quote: The slides were stained with 0.05% toluidine blue in citrate buffer (pH = 4.5) (O’Brien et al., 1964) and finally mounted on Entellan® synthetic resin (Merck KGaA, Darmstadt, Germany). Images were captured with a digital camera (Olympus DP71 ...
-
bioRxiv - Plant Biology 2024Quote: ... Ultrapure water (< 2 ppb TOC) was produced using a Milli-Q Advantage A10 water purification system (Merck, Burlington, MA, USA). For mass calibration ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl and further concentrated using Amicon Ultra concentrators from Millipore (Merck, Germany) with a 30,000 Da molecular weight cut-off ...
-
bioRxiv - Biophysics 2024Quote: ... Oocytes were then incubated in 20 μM Biotin (Merck) at 18°C for 40 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which it was separated and transferred to a polyvinylidene fluoride membrane (IPVH00010, Merck) at 100 V for 90 min ...
-
bioRxiv - Molecular Biology 2024Quote: K562 cells were cultured in RPMI-1640 (Merck #R8758) growth medium supplemented with 10 % FBS (Cellsera AU-FBS/SF ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary antibodies used were rabbit anti-TH (1:1000; AB152, Merck-Millipore), mouse anti-TH (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-TH (1:1000; MAB318, Merck-Millipore), Mouse anti-GABAA-R(1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The upper aqueous phase was then transferred to a new tube and mixed with 240 μL isopropanol (catalog no. 15-2320, Merck), to precipitate the RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The zona pellucida was removed by treating the embryos with acidic Tyrode’s solution (catalog no. MR-0040-D, Merck). The embryos were fixed in 4% paraformaldehyde (catalog no ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cumulus cells were removed by briefly culturing the zygotes in potassium simplex optimization medium (KSOM) (catalog no. MR-101-D, Merck) supplemented with 0.3 µg.µL-1 hyaluronidase (catalog no ...
-
bioRxiv - Cell Biology 2024Quote: The in situ PLA (Merck) was performed according the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... sorbitol or NaCl (Merck).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... A 6:4 ratio of 0.1 % Oil-Red-O in isopropanol to 4 mL distilled water was prepared and passed through a 0.22 □m syringe filter (Merck: Z260479) before use ...
-
bioRxiv - Neuroscience 2024Quote: ... 20% FBS (Merck Life Sciences), 50 μg/ml Insulin (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... 25 μl/ml α-amanitin solution (Merck Life Sciences) was added to the medium for 8h ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were maintained with Growth Medium consisting of high glucose DMEM (Merck Life Sciences), 1X Glutamax ...
-
bioRxiv - Neuroscience 2024Quote: Cells were left untreated or treated with 0.5 mM sodium arsenite (Merck Life Sciences) to induce acute oxidative stress for 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... concentrated with an Amicon Ultra 50K NMWL (Merck Millipore), and ultracentrifuged (45,000 rpm for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2 µM Thiazovivin (Merck Millipore) on the first day after passaging with daily medium change for at least ten passages before being used for molecular karyotyping ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were stained and visualized in the solution of 0.5% Crystal Violet (Merck) and 20% ethanol (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 µg/ml Polybrene Transfection Reagent (Merck). After 24 h of incubation ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20% ethanol (Merck). Once the colonies were stained ...
-
bioRxiv - Neuroscience 2024Quote: ... then washed with PBS with calcium chloride and magnesium chloride (Merck Life Sciences) and permeabilized with a solution of 0.5% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 µM SU5402 (both from Merck Life Sciences) and 1 µg/ml doxycycline for 3 days ...
-
bioRxiv - Neuroscience 2024Quote: ... The next day differentiation was induced in DMEM/F12 (Dulbecco’s Modified Eagle’s Medium/ Nutrient Mixture F-12 Ham; Merck Life Sciences), 1X Glutamax (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-TUJ1 (1:1000; T2200, Merck Life Sciences) was diluted in the same solution and incubated for 1 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.2% Triton X-100 and PBS (Merck Life Sciences) for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng/ml doxycycline and 2μM AraC (Merck Life Sciences). At day 4 ...
-
bioRxiv - Neuroscience 2024Quote: ... Neurons were maintained in Neurobasal/B27 supplemented with 20 ng/ml L-ascorbic acid (Merck Life Sciences), 20 ng/ml BDNF (PreproTech ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 μg/ml laminin (Merck Life Sciences) and 0.01 μg/ml agrin (R&D system) ...
-
bioRxiv - Cell Biology 2024Quote: ... lonafarnib (SCH66336; Merck) was dissolved in dimethylsulfoxide (DMSO ...