Labshake search
Citations for Merck :
1001 - 1050 of 3874 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... concentration and buffer exchange to TE (10 mM Tris-HCl pH7.5 and 1 mM EDTA) with an Amicon Ultra-4 centrifuge filter unit42 (30 kDa cut-off, Merck). Concentration of all plasmids was measured by NanoDrop One (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 24 h at +4°C with primary antibodies (goat anti-Chat (1:200, Merck, AB144P), mouse anti-GFAP (1:300 ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was concentrated by ultrafiltration (4°C, 3,500 x g) using Amicon Ultra Centrifugal Filter Units 10K molecular weight cut-off (MWCO) (Merck). CT produced in E ...
-
bioRxiv - Cell Biology 2023Quote: ... Calibration curves were acquired using defined amounts of the fluorescent product 4-methylumbelliferone sodium salt (#M1508, Sigma-Aldrich/Merck). Fluorescence of 4-methylumbelliferone was normalized to crystal violet intensity.
-
bioRxiv - Developmental Biology 2023Quote: Axolotl embryos of genotype tgSceI(Mmu.Prrx1:TFPnls-T2A-ERT2-Cre-ERT2; Caggs:loxP-GFP -loxP-mCherry)Etnka were treated with 4-OHT (Merck H7904) as described in 48 to permanently label connective tissue cells with mCherry ...
-
bioRxiv - Biochemistry 2024Quote: ... containing kinase assay buffer (final concentration: 40 mM HEPES, 120 mM NaCl, [pH 7.5] and 0.3% CHAPS, 4 mM MnCl2 (Merck, 1059270100), 10 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... 2.7 mL of each sample was transferred into an Amicon Ultra-4 3K (3000 MWCO) filtration tube (Merck Millipore) and centrifuged for 40 minutes at 6225 g ...
-
bioRxiv - Physiology 2024Quote: ... Membrane was incubated overnight at 4°C with specific mouse monoclonal primary antibody anti-puromycin (Merck, MABE343, 1:1000) and after wash ...
-
bioRxiv - Plant Biology 2024Quote: ... The lumen proteins were concentrated at 14,000 rpm for 10 min at 4 °C using Amicon ultra-0.5 centrifugal filters (Cat. No. UFC500324, Merck millipore). All solutions contained protease inhibitors with final concentration of 1 mM benzamidine ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet containing the FoIV1-rORF4 inclusion bodies was obtained by centrifugation at 12,000 × g for 20 min at 4°C and then suspended in 0.1× BugBuster Protein Extraction Reagent (Merck KGaA) using a homogenizer ...
-
bioRxiv - Biochemistry 2024Quote: ... for 4 h at 4°C and then concentrated to 200 ng/μl using Amicon Ultra-0.5 centrifugal filter units (Merck). Nucleosomes are then diluted with ice-cold 0 M FRET buffer to a concentration of 50 nM ...
-
bioRxiv - Developmental Biology 2024Quote: ... EBs were permeabilised with 0.5% Triton X-100/PBS for 1 hour and blocked for 1 hour with 4% donkey serum/PBS (Merck), both at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by overnight incubation at 4°C with 250µl of the anti-DIG antibody (Merck #11093274910 diluted 1:2000) and other necessary primary antibodies (when additional immunostaining was needed ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells (8 × 104) were seeded on fibronectin (bovine, 0.1 mg/mL) coated Millicell EZ SLIDE 8-Well (Merck) in 300 µL media/well (RPMI + 10% FCS + 1% ultraglutamine + 1% Pen/Strep + 1% HEPES + 1% Na-pyruvate + 1% MEM NEAA + 0.1% mercaptoethanol).
-
bioRxiv - Physiology 2023Quote: ... phloretin (50 mg/L; n=8) or ritonavir (60 mg/L; n=8) (all from Merck, Darmstadt, Germany) in 20 mL of 2.3 % glucose peritoneal dialysis fluid (Balance ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biophysics 2021Quote: Fmoc (9-fluorenylmethyloxycarbonyl)-amino acids were obtained from Novabiochem (Merck Biosciences, La Jolla, CA). Rink amide MBHA resin (0.65 mmol/g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells in IMDM+Glutamax medium were cryopreserved in liquid nitrogen until time of analysis complemented 1:1 with 80% FCS and 20% dimethyl sulfoxide (DMSO) (Merck).
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM stock solution was prepared by dissolving ROCKi powder in 100% dimethyl sulfoxide (DMSO, Merck Life Science, UK, #D8418) and filtered through 0.22µM syringe filters ...
-
bioRxiv - Microbiology 2020Quote: Stock solutions of crude extracts and fractions were prepared at a concentration of 100 mg/ml in 10% dimethyl sulfoxide (DMSO - Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... the cells pellet was resuspended with a freezing medium composed of 90% KSR and 10% of Dimethyl Sulfoxide (DMSO, #D2438, Merck). Cell vials were stored in a liquid nitrogen tank.
-
bioRxiv - Microbiology 2023Quote: ... was dissolved at 10 mg/ml in dimethyl sulfoxide and diluted directly in broth. Sodium dodecyl sulfate (SDS; Catalog No. 428018) was purchased from Merck. Dispersin B was obtained from Kane Biotech (Winnipeg MB ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 μg/mL Calcein AM (Merck, Germany), 4 μg/mL PI (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.001% phenol red (Merck, 143-74-8), pH 7.8) ...
-
bioRxiv - Neuroscience 2020Quote: ... and one 11μM nylon filter (NY1102500, Merck Millipore). The filtrate was centrifuged at 1500 rcf for 15 minutes at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... 250 ng of each plasmid encoding VN and VC were transfected using 4 μL of 1 μg/mL PEI (Merck) for each μg of DNA ...
-
bioRxiv - Biophysics 2021Quote: ... fluorescently-labeled and biotinylated H57-scFV were concentrated to 0.2 - 1 mg/mL with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... at 4°C in dialysis buffer (100 mM NaCl, 20mM Tris pH 7.4, containing 15 μl bovine thrombin (605157, Merck Millipore) to cleave the His-tags) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The blots were incubated with primary antibodies to the following proteins overnight at 4 °C: (1) CTCF (1:1,000; 07-729, Merck Millipore), (2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysate was spun at 19650 x g for 20 min at 4 °C and the cleared supernatant was filtered in a 0.45 μm filter (Merck Millipore). M2 magnetic FLAG beads (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4°C) and the EV-depleted supernatant was filtered through a 0.22 μm pore PVDF Millex-HV filter (Merck Millipore) and analysed by NTA ...
-
bioRxiv - Microbiology 2021Quote: ... containing a knockout of DNA Ligase 4) 44 that had been made competent for DNA uptake using the LiCl2-based Yeast transformation kit (YEAST1-1KT; Merck). The transformed cells were plated on minimal synthetic defined (SD ...