Labshake search
Citations for Merck :
801 - 850 of 3874 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspension in 9 ml of RPMI-1640 medium (Merck R0883). The digest was filtered through a 40 μm cell strainer to remove undigested tissue and the filtrate was centrifuged (300g for 10 min at 4°C) ...
-
bioRxiv - Cell Biology 2024Quote: ... Nocodazole (Cat # 31430-18-9) was obtained from Merck (Darmstadt, Germany). Antibodies for ERα (Cat # sc-543) ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Immunology 2021Quote: ... the collected PBMCs were resuspended in freezing medium consisting of 10% (v/v) dimethyl sulfoxide (DMSO; Merck) and 90% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... JNK-I-8 (Merck SML1246), SB-203580 (MedKoo ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-8-oxoguanine (MAB3560, Merck), anti-phospho-histone H2AX (Ser 139 ...
-
Tracer-based metabolomics for profiling nitric oxide metabolites in a 3D microvessel-on-a-chip modelbioRxiv - Cell Biology 2023Quote: ... BH4 (Merck, 69056-38-8). RPMI SILAC - medium deficient in Arginine was obtained from (Thermofisher ...
-
bioRxiv - Genetics 2024Quote: ... 8 ng/µl polybrene (Merck) was added to the culture medium to enhance efficiency ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Microbiology 2024Quote: ... One-centimeter length of colon was homogenized (50 mg/mL) in ice-cold 50mM potassium phosphate buffer (pH 6) containing 5% hexadecyl trimethyl ammonium bromide (Merck) and hydrogen peroxide (0.0005%) ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Organoid cells were cultured in self-renewing medium with ROCKi for 8 days before Dox (Doxycycline hyclate, 2 µg/ml, Merck, D9891) and TMP (Trimethoprim ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mM MgCl2 (optimal ATP to MgCl2 ratio), 0.2 mM NADH, 2 mM PEP, 8 U PK (rabbit muscle, (Merck, Darmstadt, Germany)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Postoperative care included antibiotic and analgesic administration (2.27% enrofloxacin, 5 mg/kg, Bayer, Kiel, Germany and 0.3 mg/ml buprenorphine, 8 µg/kg, Buprex, Merck & Co., Inc., NJ, USA) in a controlled temperature environment (37°C) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The tissue was washed in PBS and incubated in 5 mM EDTA solution in PBS (pH 8; Merck Millipore, Burlington, MA, USA) at 4°C for 30 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing STAR635P-conjugated mSAv were concentrated with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Monomeric STAR635P-labeled mSAv-DNA was concentrated with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing STAR635P-conjugated mSAV were concentrated with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and conjugated to trans-Cyclooctene-PEG3-Maleimide (TCO-PEG3-Maleimide ...
-
bioRxiv - Cancer Biology 2021Quote: ... Organoids were washed once with ice-cold PBS and were fixed by 4% PFA (#1004965000, Merck Millipore) for 20 min at RT and stored in PBS at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... then incubated overnight at 4°C with anti-KCC2 (1:200; Merck Life Sciences, Italy, #07-432) or anti-IGF-1R β (1:100 ...
-
bioRxiv - Pathology 2021Quote: ... The proteins were cleaned using Amicon Ultra-4 Centrifugal Filter Devices (15 ml, 10 kD; Merck Millipore) to remove the elution buffer ...
-
bioRxiv - Microbiology 2021Quote: Yeast cells were digested at 90°C for 4 hours in 65% (w/v) HNO3 (Suprapur, Merck). Mineralized samples were diluted in 0.5% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... Protein samples were separated by SDS–PAGE (4-20%) and blotted onto polyvinylidene fluoride membranes (Merck Millipore). Membranes were blocked for 1 h with Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Elutions containing VgrG5-CTD were desalted using Amicon Ultra-4 Centrifugal Filter Units (Merck Millipore Ltd., UFC801096) into 10 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... was cultured in high-glucose (4.5 g × ml−1) Dulbecco’s modified Eagle’s medium (DMEM) containing 4 mM stable glutamine (Merck) and supplemented with 6% inactivated fetal calf serum (iFCS ...
-
bioRxiv - Neuroscience 2020Quote: ... samples were incubated overnight at 4°C with primary antibodies against puromycin (1:500, MABE343, Merck Millipore), βIII tubulin (1:500 ...
-
bioRxiv - Genetics 2020Quote: The cells were washed once with DPBS and fixed for 15 minutes with 4% paraformaldehyde (Merck Millipore), followed by three rinses with DPBS ...
-
bioRxiv - Immunology 2020Quote: ... the cells were further cultured for 4 days in the same conditions plus Dexamethasone (1 μM; MERCK). IDCs were equally generated in 4 days ...
-
bioRxiv - Microbiology 2021Quote: ... and adjusted before inoculation to the desirable level (ranged from 2.6 to 6.5 ± 0.1) by adding 4 M NaOH (Merck) or 4 M HCL (Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT, 11383213001, Merck-SIGMA) and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP ...
-
bioRxiv - Cancer Biology 2022Quote: ... were coated overnight at 4 °C with 2.5 µg/ml of bovine plasma fibronectin (Merck-Millipore, 341631) and collagen type I (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The peak was pooled and concentrated by centrifugal filtration (Amicon Ultra-4, 10 kDa cut-off, Merck) rebuffered in storage buffer (20 mM HEPES/KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The mixture was transferred to a 100 kDa MWCO Amicon Ultra-4 centrifugal filter unit (#UFC810008, Merck) centrifuged at 7500g ...
-
bioRxiv - Plant Biology 2024Quote: ... and proteins were concentrated using a 30 kDa Amicon Ultra-4 Centrifugal Filter Unit (Merck Milipore; www.merckmillipore.com). Protein concentration was determined employing the Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... Digestion was followed by a Tris-EDTA wash using Amicon® Ultra 4 mL filter (Merck Millipore) followed by a DNA purification step using the “QIAQuick minElute purification kit” (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions containing LmdC were concentrated in an Amicon Ultra-4 10K spin concentrator (MWCO 10,000; Merck, Germany). After the removal of precipitates by centrifugation at 30,000 ×g for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Hydroxyurea (HU) was used at 4 mM and nocodazole at 0.2 µg/ml (all acquired from Merck).
-
bioRxiv - Bioengineering 2024Quote: ... PLGA 50:50 (Lactel/Evonik B6010-4) and PLGA 85:15 (Expansorb® DLG 85-7E, Merck) were both ester terminated ...
-
bioRxiv - Immunology 2023Quote: ... fractions containing monomeric scFV were concentrated with Amicon Ultra-4 centrifugal filters (10 kDa cut off, Merck). 14.4.4 scFV without an unpaired cysteine were randomly conjugated on surface-exposed lysine residues with Alexa Fluor 555 carboxylic acid ...
-
bioRxiv - Immunology 2023Quote: ... Cytiva) and monomeric fractions were concentrated with Amicon Ultra-4 centrifugal filters (10 kDa cut off, Merck).
-
bioRxiv - Microbiology 2023Quote: ... the sample was concentrated to 500 μl using a 100 kDa concentrator (Amicon Ultra 4 - Merck Millipore) injected on an ÄKTA pure FPLC using a Superose 6 increase column 10/300 GL (Cytiva ...
-
bioRxiv - Biophysics 2023Quote: ... the LUVs were transferred to an Amicon Ultra-4 100 kDa centrifugal filter unit (Merck, Darmstadt, Germany) and concentrated by centrifuging at 2000g ...