Labshake search
Citations for Merck :
801 - 850 of 6118 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.1% SDS (Merck Millipore, Burlington, MA). Primary antibodies were incubated for 1 h at RT a humid chamber ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of each sample were concentrated with Amicon ultra Centrifugal filters (Cat no. UFC510024, Merck). Samples were centrifuged (14 000 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... concentrated with Amicon Ultra-4 Centrifugal Filter Unit (100 kDa cut-off, Merck Millipore, Cat#UFC810024) to ~1 mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: Purified proteins were concentrated using Amicon® Ultra-4 Ultracel®-10K (MWCO: 10.000 Da; Merck). Protein concentrations were quantified using the calculated molar extinction coefficient ε280 (29).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The resulting ultrafiltrate (15min 14000g 15°C) was acidified with 20 µl 4% formic acid (Merck) in dH2O ...
-
bioRxiv - Biochemistry 2020Quote: ... and anti-integrin β1 antibody (clone HUTS-4) was obtained from Chemicon (Merck Millipore, Billerica, MA). Rabbit polyclonal antibodies to fibronectin and fibrinogen were from Abcam (Cambridge ...
-
bioRxiv - Neuroscience 2021Quote: ... Fractions of interest were concentrated using 10 kDa cut-off Amicon Ultra-4 concentrators (Merck Millipore) before loading on a Superdex 200 10/300 GL (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... 400 μl cell lysate were incubated with 4 μl HTT MAB2166 rabbit primary antibody (Merck, #MAB2166) for 2 hours at 4° C on a rotating device ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested DIP material was clarified (3000 × g, 10 mins and 4 °C) and sucrose (Merck, #84097) was added at a final concentration of 4 % ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Neuroscience 2022Quote: ... coated coverslips and fixated with 4% Paraformaldehyde (PFA; EMC 15710) and 0.2% Glutaraldehyde (Merck Millipore 104239) for 15 min at room temperature (RT) ...
-
bioRxiv - Neuroscience 2024Quote: ... Amicon Ultra-4 centrifugal filters with 100 kDa molecular weight cutoff (Merck Millipore, Burlington, MA, USA) along with 0.22 μM Nalgene® syringe filter units (sterile ...
-
bioRxiv - Microbiology 2023Quote: SDS gel electrophoresis was performed using pre-cast mPAGE™ 4-20% bis-tris gels (Merck) and 20 µl of PS extracts were mixed in Laemmli buffer and boiled at 95°C for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: Fresh embryos and postnatal pituitaries were fixed with 4% w/v paraformaldehyde (PFA, P6148, Merck-SIGMA) in Phosphate-Buffered Saline (PBS ...
-
bioRxiv - Genomics 2022Quote: ... the membranes were probed (overnight at 4°C) with rabbit polyclonal anti-tyrosine hydroxylase (Merck, AB152) diluted in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were decapitated and the ONs were rapidly removed and fixed with 4% paraformaldehyde (PFA – Merck) diluted in PBS for 16 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... under gentle agitation for 24 to 36 h in a fixative mixture of 4% acrylamide (Merck), 4% paraformaldehyde and 0.25% VA-044 thermal initiator (Fujifilm ...
-
bioRxiv - Neuroscience 2023Quote: ... with a stock solution of gramicidin A (4 mg/ml - dissolved in dimethyl sulfoxide, DMSO, Merck) to achieve a final concentration of 80 μg/mL gramicidin19 ...
-
bioRxiv - Cell Biology 2023Quote: The eluate was concentrated using an Amicon Ultra-4 concentrator (Merck Millipore, 10 kDa cut-off), and incubated overnight at 4°C with TEV and 3C proteases to remove the C-terminal StrepTagII and C-terminal 6xHis tag from the HAUS2 and HAUS1 subunits respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Amicon Ultra-4 centrifugal filters with 100,000 Da molecular weight cutoff (Merck Millipore, Burlington, MA, USA) along with 0.22 µM Nalgene® syringe filter units (sterile ...
-
bioRxiv - Microbiology 2024Quote: The cells in 96-well plates were fixed with 4% paraformaldehyde (PFA, Merck, Cat. no. P6148) in phosphate buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... 50.000 cells plated on coverslips were fixed for 15 min with 4% PFA (MC1040051000, Merck, Germany). Blocking was performed in 10% normal goat serum (G6767 ...
-
bioRxiv - Molecular Biology 2024Quote: ... proteins were concentrated at 3,500 rpm and 4 °C using Amicon Ultra centrifugal filter units (Merck) or using a stirred cell ultrafiltration device ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were fixed at room temperature either with 4% paraformaldehyde (D1408, Merck Life Science, Milan, Italy) solution in DPBS or with methanol (32215 ...
-
bioRxiv - Microbiology 2024Quote: ... Centrifugal units Amicon® Ultra-4 3KDa molecular weight cut-off (MWCO) were obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Biochemistry 2024Quote: ... The NuMA-containing fractions were pooled and concentrated (Amicon Ultra 4, 100 kDa MWCO [Merck Millipore]). The Strep-tag II was cleaved off by incubating with TEV protease for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and mounted on slides using Mowiol-based mounting medium (12% Mowiol 4-88 (Merck, 81381-250G), 30% glycerol ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatants were subjected to end-on rotation at 4 °C with anti-FLAG (Merck, F1804) that was pre-conjugated to Protein A/G beads (Pierce ...
-
bioRxiv - Cell Biology 2024Quote: ... d were separated on mPAGE™ 4-12% Bis-Tris Precast Gels (Merck, MP41G10 or MP41G12) through standard SDS-PAGE protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... coli C41 DE3 cells were used to inoculate 4 ml of overnight express terrific broth (Merck) with 50 µg/ml Kanamycin in 24 well plate format ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sample were incubated in ethyl cinnamate for 4 hours at room temperature (112372-100G, Merck).
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was isolated using 1-bromo-3-chloropropane (Merck) and the Analytik Jena Kit (#845-KS-2040050) ...
-
bioRxiv - Bioengineering 2020Quote: ... The structures were developed in propylene glycol methyl ether acetate (PGMEA, Merck KGaA, Darmstadt, Germany) for 25 minutes followed by 5 minutes of treatment with isopropyl alcohol (IPA ...
-
bioRxiv - Microbiology 2023Quote: ... supernatants were coated with overlay medium (1.5% methyl cellulose (w/v) (Merck KGaA; Darmstadt, Germany), 1x MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing STAR635P-conjugated mSAv were concentrated with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Monomeric STAR635P-labeled mSAv-DNA was concentrated with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20 °C ...