Labshake search
Citations for Merck :
751 - 800 of 6118 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing ELAC2 were concentrated using Amicon Ultra-4 30K Centrifugal Filter Devices (Merck Millipore), aliquoted ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... determined by means of quantitative NMR using TraceCERT® ethyl 4-(dimethylamino)benzoate from Merck as an internal calibrant [48 ...
-
bioRxiv - Biochemistry 2023Quote: ... After the standard Ni-NTA purification process using Ni-NTA beads (Merck, cat. 70666-4) and subsequent Sumo protease digestion (concentration of sumo protease at 1:200) ...
-
bioRxiv - Neuroscience 2023Quote: ... and transcardially perfused with 0.9% NaCl followed by 4% paraformaldehyde (PFA, Sigma, Merck, Germany, P6148). The brains were harvested and post-fixed overnight in 4% PFA at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized with 0.1% saponin in PBS and incubated with 4 μg/ml Hoechst 33342 (Merck) for 10 min at room temp ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then fixed and permeabilized using a combination of 4% paraformaldehyde (Sigma-Aldrich/Merck) and 0.1% Triton X-100 (Sigma-Aldrich/Merck) ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were concentrated at 3,500 rpm and 4°C using Amicon Ultra centrifugal units (Merck).
-
bioRxiv - Plant Biology 2024Quote: ... 4 mM phosphoenolpyruvate (PEP)) as well as 1.2 U pyruvate kinase (P1506; Sigma-Aldrich/Merck) were added to convert ADP and PEP to ATP and pyruvate ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The gelatinous sack surrounding the eggs was removed using 4% L-Cysteine (Merck Milipore, USA) and followed by microinjecting the zygotes with antisense MOs ...
-
bioRxiv - Genetics 2023Quote: ... individual fibers were transferred onto a 4-well chamber slide (Nunc Lab-Tek, Merck, GmbH) containing HBSS with 2.5μM FM1-43 dye (Molecular Probes ...
-
bioRxiv - Systems Biology 2024Quote: ... UK) and separated by gel electrophoresis (7.5% acrylamide, 4 mg/ml porcine gelatin; Merck, UK). SDS was removed by washing in 50 mM Tris.HCl ...
-
bioRxiv - Cell Biology 2024Quote: Cultured cells for 24 hours of incubation were fixed with 4% paraformaldehyde (PFA) (#104005, Merck) in Hank’s balanced salt solution containing 1 mM Ca2+ and Mg2+ ...
-
bioRxiv - Microbiology 2024Quote: ... and used to transduce HeLa cells in the presence of 4 µg/ml polybrene (Merck). At 24 hours post-transduction ...
-
bioRxiv - Biochemistry 2024Quote: ... We then stimulated the cells for 4 h with 100 ng/ml PMA (524400; Merck) and 1 µg/ml ionomycin (407952 ...
-
bioRxiv - Cell Biology 2024Quote: ... and separated on mPAGE™ 4-12% Bis-Tris Precast Gels (Merck, MP41G10 or MP41G12) through standard SDS-PAGE protocol ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated O/N at 4 °C with the following primary antibodies: mouse anti-glial fibrillary acidic protein (GFAP; Merck, Madrid, Spain; #MAB360; 1:1000) and rabbit anti-ionized calcium-binding adaptor molecule 1 (Iba1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Bioengineering 2021Quote: BCP and BG samples dehydrated and embedded in poly-methyl-methacrylate resin (Merck KGaA). Sections performed with Leica SP1600 microtome (Wetzlar ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Carbamate (aldicarb) and organophosphates (paraoxon-ethyl, paraoxon-methyl and DFP) were acquired from Merck and dissolved in 70% ethanol and 100% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Trimethylsilyl methyl glycosides were obtained by derivatization with the reagent Sylon™ HTP (Merck) after methanolysis of the polysaccharide with 3 M HCl in methanol at 85°C for 16 h (69) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The final clarification was achieved in Methyl Salicylate (M6752, MERCK Sigma Aldrich, MA, USA), which also served as both a storage and mounting medium.
-
bioRxiv - Neuroscience 2024Quote: ... and derivatizing with twice the volume of N-methyl-N-trimethylsilyltrifluoroacetamid (MSTFA) (Merck, Germany) to yield trimethylsilylated analytes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Microbiology 2021Quote: ... the pseudoparticles were added to the cells pre-incubated with inhibitors Bromhexine hydrochloride (Merck), Ambroxol hydrochloride (Merck) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.
-
bioRxiv - Neuroscience 2024Quote: ... Cytosine β-D-arabinofuranoside hydrochloride (Ara-C) (cat# C6645) (both from Merck, Auckland, NZ). BDNF (cat# RDS248BDB050) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Blocks of cells or tissue were incubated overnight in 2.3M sucrose at 4°C (Merck, K17687153) in 0.1M phosphate buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Stained sections were washed 4 times in PBS and then embedded using Aquatex (Merck Millipore, USA).
-
bioRxiv - Synthetic Biology 2021Quote: ... the medium was removed and cells were fixed for 10 min in 4% formaldehyde solution (Merck). The fixation solution was removed and the cells were washed twice with nuclease-free H2O (nfH2O) ...