Labshake search
Citations for Merck :
751 - 800 of 3874 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer of the eluted fractions containing 6xHis-HULla was replaced by buffer G (50 mM Tris pH 8, 200 mM NaCl) in Amicon® Ultra – 3 kD Centrifugal Filters (Merck KGaA, Germany) and resulting solution was injected in a heparin column ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with following primary antibodies at 4 °C overnight: TRA-1-60 (Merck Millipore), OCT3/4 (H-134 ...
-
bioRxiv - Microbiology 2021Quote: Blocks of cells or tissue were incubated overnight in 2.3M sucrose at 4°C (Merck, K17687153) in 0.1M phosphate buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... CD14+-cells were detached in a similar manner: 4 mg/mL lidocaine hydrochloride (L5647; Merck KGaA) were solved in Versene Solution freshly for each detachment ...
-
bioRxiv - Neuroscience 2021Quote: ... Stained sections were washed 4 times in PBS and then embedded using Aquatex (Merck Millipore, USA).
-
bioRxiv - Synthetic Biology 2021Quote: ... the medium was removed and cells were fixed for 10 min in 4% formaldehyde solution (Merck). The fixation solution was removed and the cells were washed twice with nuclease-free H2O (nfH2O) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.1% SDS (Merck Millipore, Burlington, MA). Primary antibodies were incubated for 1 h at RT a humid chamber ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of each sample were concentrated with Amicon ultra Centrifugal filters (Cat no. UFC510024, Merck). Samples were centrifuged (14 000 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... concentrated with Amicon Ultra-4 Centrifugal Filter Unit (100 kDa cut-off, Merck Millipore, Cat#UFC810024) to ~1 mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: Purified proteins were concentrated using Amicon® Ultra-4 Ultracel®-10K (MWCO: 10.000 Da; Merck). Protein concentrations were quantified using the calculated molar extinction coefficient ε280 (29).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The resulting ultrafiltrate (15min 14000g 15°C) was acidified with 20 µl 4% formic acid (Merck) in dH2O ...
-
bioRxiv - Biochemistry 2020Quote: ... and anti-integrin β1 antibody (clone HUTS-4) was obtained from Chemicon (Merck Millipore, Billerica, MA). Rabbit polyclonal antibodies to fibronectin and fibrinogen were from Abcam (Cambridge ...
-
bioRxiv - Developmental Biology 2021Quote: ... iPSC-derived mesodermal cells were fed with basal medium supplemented with 4 μM IWR-1 (Merck) for 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Fractions of interest were concentrated using 10 kDa cut-off Amicon Ultra-4 concentrators (Merck Millipore) before loading on a Superdex 200 10/300 GL (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... 400 μl cell lysate were incubated with 4 μl HTT MAB2166 rabbit primary antibody (Merck, #MAB2166) for 2 hours at 4° C on a rotating device ...
-
bioRxiv - Neuroscience 2021Quote: ... or Cy5-conjugated secondary antibodies (1:200; AP192SA6; Merck Millipore, USA; 17 hrs at 4°C). Similar immunolabeling steps were followed for the subsequent sequential staining ...
-
bioRxiv - Immunology 2020Quote: ... BJ-5at fibroblasts were kept in a 4:1 mixture of the Dulbecco’s Medium (Merck, #D6429) and Medium 199 (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested DIP material was clarified (3000 × g, 10 mins and 4 °C) and sucrose (Merck, #84097) was added at a final concentration of 4 % ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Neuroscience 2022Quote: ... coated coverslips and fixated with 4% Paraformaldehyde (PFA; EMC 15710) and 0.2% Glutaraldehyde (Merck Millipore 104239) for 15 min at room temperature (RT) ...
-
bioRxiv - Neuroscience 2024Quote: ... Amicon Ultra-4 centrifugal filters with 100 kDa molecular weight cutoff (Merck Millipore, Burlington, MA, USA) along with 0.22 μM Nalgene® syringe filter units (sterile ...
-
bioRxiv - Microbiology 2023Quote: SDS gel electrophoresis was performed using pre-cast mPAGE™ 4-20% bis-tris gels (Merck) and 20 µl of PS extracts were mixed in Laemmli buffer and boiled at 95°C for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: Fresh embryos and postnatal pituitaries were fixed with 4% w/v paraformaldehyde (PFA, P6148, Merck-SIGMA) in Phosphate-Buffered Saline (PBS ...
-
bioRxiv - Genomics 2022Quote: ... the membranes were probed (overnight at 4°C) with rabbit polyclonal anti-tyrosine hydroxylase (Merck, AB152) diluted in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were decapitated and the ONs were rapidly removed and fixed with 4% paraformaldehyde (PFA – Merck) diluted in PBS for 16 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... under gentle agitation for 24 to 36 h in a fixative mixture of 4% acrylamide (Merck), 4% paraformaldehyde and 0.25% VA-044 thermal initiator (Fujifilm ...
-
bioRxiv - Cell Biology 2023Quote: The eluate was concentrated using an Amicon Ultra-4 concentrator (Merck Millipore, 10 kDa cut-off), and incubated overnight at 4°C with TEV and 3C proteases to remove the C-terminal StrepTagII and C-terminal 6xHis tag from the HAUS2 and HAUS1 subunits respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Amicon Ultra-4 centrifugal filters with 100,000 Da molecular weight cutoff (Merck Millipore, Burlington, MA, USA) along with 0.22 µM Nalgene® syringe filter units (sterile ...
-
bioRxiv - Microbiology 2024Quote: The cells in 96-well plates were fixed with 4% paraformaldehyde (PFA, Merck, Cat. no. P6148) in phosphate buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... 50.000 cells plated on coverslips were fixed for 15 min with 4% PFA (MC1040051000, Merck, Germany). Blocking was performed in 10% normal goat serum (G6767 ...
-
bioRxiv - Molecular Biology 2024Quote: ... proteins were concentrated at 3,500 rpm and 4 °C using Amicon Ultra centrifugal filter units (Merck) or using a stirred cell ultrafiltration device ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were fixed at room temperature either with 4% paraformaldehyde (D1408, Merck Life Science, Milan, Italy) solution in DPBS or with methanol (32215 ...
-
bioRxiv - Microbiology 2024Quote: ... Centrifugal units Amicon® Ultra-4 3KDa molecular weight cut-off (MWCO) were obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Biochemistry 2024Quote: ... The NuMA-containing fractions were pooled and concentrated (Amicon Ultra 4, 100 kDa MWCO [Merck Millipore]). The Strep-tag II was cleaved off by incubating with TEV protease for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and mounted on slides using Mowiol-based mounting medium (12% Mowiol 4-88 (Merck, 81381-250G), 30% glycerol ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatants were subjected to end-on rotation at 4 °C with anti-FLAG (Merck, F1804) that was pre-conjugated to Protein A/G beads (Pierce ...
-
bioRxiv - Cell Biology 2024Quote: ... d were separated on mPAGE™ 4-12% Bis-Tris Precast Gels (Merck, MP41G10 or MP41G12) through standard SDS-PAGE protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... coli C41 DE3 cells were used to inoculate 4 ml of overnight express terrific broth (Merck) with 50 µg/ml Kanamycin in 24 well plate format ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sample were incubated in ethyl cinnamate for 4 hours at room temperature (112372-100G, Merck).