Labshake search
Citations for Merck :
751 - 800 of 3358 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Microbiology 2024Quote: ... One-centimeter length of colon was homogenized (50 mg/mL) in ice-cold 50mM potassium phosphate buffer (pH 6) containing 5% hexadecyl trimethyl ammonium bromide (Merck) and hydrogen peroxide (0.0005%) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were incubated overnight and were treated with 2 IU/ml hCG (Merck Sharp & Dohme B.V. ...
-
bioRxiv - Cell Biology 2022Quote: ... Snap-Streptavidin-WA (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Centrin-2 (1:250, clone 20H5, 04-1624, Merck Millipore), rabbit polyclonal anti-WDR90 (1:250 ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 2% B27 (v/v)) or BrightCellTM NEUMO photostable medium (1X NEUMO (Merck Millipore), 4% SOS ...
-
bioRxiv - Cell Biology 2021Quote: ... A dose of 300mg/1kg body weight of APAP (Merck, 103-90-2) was injected i.p at a concentration of 40mg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 2ml/well of overlay {MEM containing 2% FBS and 0.4% Tragacanth (Merck, Israel)} was added to each well and plates were incubated at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Erythrocytes were removed from peripheral blood by Dextran sedimentation (2 % in PBS; Merck) and ACK lysis buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were grown in RPMI1640 supplemented with 2 mM glutamine (Merck, Darmstadt, Germany) and 10 % Fetal Bovine Serum (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... LB agar medium (Bacto) was prepared with 2% sodium carboxymethyl cellulose (CMC) (Merck) or 2% pectin (Agdia AG366 ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The MNase reaction is stopped by adding 2 mM EGTA (Sigma-Aldrich/Merck). Afterwards ...
-
bioRxiv - Biochemistry 2022Quote: ... transferred and tris-(2-carboxyethyl)-phosphin (TCEP, Merck, Sigma-Aldrich, 646547-10×1ML) added up to 1 mM and cysteine reduction performed for 30 min at 60°C ...
-
bioRxiv - Plant Biology 2022Quote: ... coli strains derived from BL21(DE3) and Rosetta 2 (Merck Millipore, Burlington, USA), BL21(DE3)-R3-pRARE2 and BL21(DE3)-R3-lambda-PPase ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were reduced by 1 mM tris(2-carboxyethyl)phosphine (TCEP, Merck) and free sulfhydryl groups carbamidomethylated using 5.5 mM chloroacetamide (Sigma-Aldrich) ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were seeded in poly-HEMA (poly-2-hydroxyethyl methacrylate)-coated dishes (Merck) for embryoid bodies (EBs ...
-
bioRxiv - Cell Biology 2023Quote: ... Nonspecific antibody blocking was for 1 h with 2% bovine serum albumin (Merck) in Tris-buffered saline ...
-
bioRxiv - Cell Biology 2023Quote: ... they were supplemented with 2 µg/ml Hoechst 33342 (Merck, cat. No. B2261). All the antibodies used are listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and human recombinant FGF-2 (10 ng/ml; Merck Millipore, Burlington, MA, USA) as mitogens ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed four times with PBS and lysed with 2% saponin (Merck) for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-Vinculin (Clone H Vin 1 0, 2 Ml; Cat. #V9131) from Merck. Anti-HA-11 epitope tag ...
-
bioRxiv - Microbiology 2023Quote: ... A 2 % chitosan solution was obtained by dissolving chitosan (high purity, 740063 Merck) in milliQ water with 0.13 % (vol/vol ...
-
bioRxiv - Immunology 2023Quote: ... The cells were cultured in the presence of 2 µg/ml puromycin (Merck) until the mortality of non-infected cells reached 100% leaving cells transfected with shRNA alive ...
-
bioRxiv - Cell Biology 2023Quote: Caco-2 cells were co-transfected with eSpCas9-GFP protein (Merck, cat #ECAS9GFPPR) and sygRNA (Merck ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 2 U mL−1 catalase from bovine liver (Merck-MilliPoreSigma, ref. C1345). NADH was added at a final concentration of 1 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2h before clearing in benzyl alcohol:benzyl benzoate (1:2) (Sigma-Aldrich-Merck). Samples were stored in this solution at room temperature and protected from light.
-
bioRxiv - Neuroscience 2024Quote: ... 2 was determined by staining with the DNA dye Hoechst 33258 (861405, Merck) as described previously (Saga et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... H&L Chain Specific Peroxidase Conjugate (Merck, Cat#: 401215-2 ML, 1:5000), or Goat Anti-Rabbit IgG ...
-
bioRxiv - Cancer Biology 2024Quote: ... H & L Chain Specific Peroxidase Conjugate (Merck, Cat#: 401315-2 ML, 1:5000). Proteins were detected by chemiluminscent detection system (Tanon ...
-
bioRxiv - Immunology 2024Quote: ... Dimethyl 2-oxoglutarate (DM-OG) was purchased from Merck (cat no: 349631-5G) and added to the culture medium at 2mM and 4mM final concentrations.
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by day 2 inoculation into 1 mL overnight autoinduction media (Merck, USA) with 50 µg/mL kanamycin ...
-
bioRxiv - Plant Biology 2024Quote: ... D-fructose (Merck), MLG43 (O- BGTRIB ...
-
bioRxiv - Cell Biology 2022Quote: ... asynchronous cells were treated with 9 μM RO-3306 (Merck Life Sciences) for 16 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck: XTG9-RO) transfection reagent according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and 230 µl of the 9 mol/L sulphuric acid (Merck Millipore) was added and mixed ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were coated with 9-AA (Merck Life Science, Dorset, UK) at 10 mg/mL in 80:20 ethanol:water by TM Sprayer (HTX Technologies ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.08 µM MnCl2·4H2O (Merck/Sigma-Aldrich, CAS number : 13446-34-9), 1.65 µM Na2MoO4·2H2O (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.615 mM L-glutamine (Merck/Sigma-Aldrich, CAS number : 56-85-9), 0.8 mM glycine (Merck/Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The staining of the precipitated polypeptide-antibody complexes was performed by addition of 60 mg 4-chloro-1 naphtol (Merck/Sigma-Aldrich; Cat#C8890) in 20 ml ice-cold methanol to 100 ml phosphate buffered saline (PBS ...
-
bioRxiv - Pathology 2022Quote: ... fixed smears or tissue section were stained for 15 minutes with Auramine O (0.5g AuO, Merck, Darmstadt ...
-
bioRxiv - Immunology 2023Quote: ... Bound antibodies were detected with the horseradish peroxidase (HRP) substrate o-phenylenediamine (Merck KGaA, Darmstadt, Germany). The reactions were stopped with 1 M H2SO4 after 20 min and the absorbance was measured in a microplate reader (Benchmark ...