Labshake search
Citations for Merck :
951 - 1000 of 3358 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The proteins were next transferred onto Immobilon P membrane (Merck) and probed with Ni-NTA-HRP.
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were electroblotted to 0.45μm PVDF membranes (Imobilon-P, Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and transferred to an Immobilon-P membrane (Merck Millipore IPVH00010) in 1X Tris/glycine buffer (diluted from 10X Tris/glycine buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 mg/ml collagenase P (Merck, Kenilworth New Jersey) in Dulbecco’s Modified Eagle Medium (DMEM/high glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by transfer to Immobilon®-P PVDF membranes (Merck). Membranes were blocked in 0.2% iBlock (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% Nonidet P-40) supplemented with protease (Merck Sigma, 5892970001) and phosphatase (Merck Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and transferred to PVDF sheets (Immobilion-P, MERCK, Burlington, USA). Membranes were blocked with bovine serum albumin 5% for 30 min at room temperature and then ...
-
bioRxiv - Cell Biology 2022Quote: ... Separated proteins were transferred onto Immobilon-P PVDF membrane (Merck) using Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell (Bio-Rad Laboratories) ...
-
bioRxiv - Molecular Biology 2020Quote: ... transferred to the Immobilon-P/E PVDF membrane (Merck Millipore), and immunodetected using the SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transferred onto 0.45μm PVDF membrane (Immobilon-P; Merck Millipore) and probed with the specified antibody overnight at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Proteins were transferred to Immobilon-P membrane (Merck Millipore Ltd.) and westerns preformed with Ift140 (23 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and electro-transferred onto PVDF membranes (Merck, Immobilon-P membrane). Membranes were blocked with 5% skim milk and then incubated with primary antibodies ...
-
bioRxiv - Systems Biology 2024Quote: ... and transferred to an Immobilon-P PVDF membrane (Merck Millipore) using a wet-chamber system ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to polyvinylidene difluoride (PVDF) Immobilon-P membranes (Merck Millipore) and blocked in Tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2024Quote: ... 1x penicillin and streptomycin (P/S, Merck, Cat. no. P0781) and incubated at 37 °C in 5% CO2 atmosphere.
-
bioRxiv - Bioengineering 2024Quote: ... transferred to Immobilon-P PVDF membrane (IPVH00010, Merck Life Science), and blocked by 5% Non-Fat milk/TBST (Tris buffered saline with 0.1 % Tween 20 ...
-
bioRxiv - Microbiology 2024Quote: ... The proteins were electroblotted onto Immobilon-P transfer membranes (Merck). Thereafter ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.
-
bioRxiv - Biophysics 2020Quote: ... functionalized with either 100 μg/mL poly-D-lysine overnight for microglia cells or with 0.2 mg/mL fibronectin (FC010, Merck, 1:5 in PBS) for 2h at 37°C for fibroblasts ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST42-Ctdnep1_C-ter plasmid was transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore), Bacteria cultures (500 ml ...
-
bioRxiv - Cell Biology 2020Quote: A549 cells were treated with 2 ng/ml TGF-β1 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 2 days in DMEM with 10% FBS on non-treated culture dish surfaces (31 ...
-
bioRxiv - Immunology 2020Quote: ... After each cycle the flow channels were regenerated for 10 seconds with 2 M NaCl (Merck) at 10 µL/min ...
-
bioRxiv - Genomics 2021Quote: ... Prior to protein quantification milk was diluted 1:2 in assay buffer (Merck-Millipore, Burlington, USA). Concentrations for 15 cytokines (IL-1α ...
-
bioRxiv - Bioengineering 2021Quote: ... with Pellicon 2 mini cassettes (300 kDa, 0.1 m2, BioMax polyethersulfone membrane with C-screen; Merck), as previously described (4) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were plated at a density of 100,000cm-2 in 96 well plates (Corning, MERCK UK), with wells previously coated for 24h with 20μg/ml FHL-1 ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37°C and purified using a Amicon 30 kDa MWCO filter (Merck). Deep Vent exo-DNA polymerase (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were 12 x serially diluted 1:2 in a 96-well plate (Merck, Darmstadt, Germany) starting with 4000 cells in the first column ...
-
bioRxiv - Immunology 2021Quote: ... The left lung was inflated with 0.6mL PBS/2% (w/v) low melting point agarose (Merck) in PBS ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in serum-free MEM supplemented with 2 µg/mL TPCK-treated trypsin (Merck) for 2 days at 37 °C in 5 % CO2 ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at a concentration of 10×106/100μL in PBS containing 2% FCS (Merck). Staining for cell surface antigens was performed for 20 minutes at 4°C in the dark ...
-
bioRxiv - Neuroscience 2023Quote: ... Non-adherent cell culture plates were prepared with poly(2-hydroxyethyl methacrylate) (poly-HEMA; P3932, Merck) coating ...
-
bioRxiv - Microbiology 2023Quote: ... One mL of culture broth was mixed in a 2:1 ratio with chloroform (Merck, Mumbai), followed by centrifugation (15,300 g ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified cells were cultured into organoids and treated with 2 μg/ml doxycycline (DOX, Merck, D9891) and 10 μM trimethoprim (TMP ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Finally, clearing was performed in BABB (benzyl alcohol:benzyl benzoate 1:2, (Merck 8187011000 and Sigma 108006) for 48h.
-
bioRxiv - Biophysics 2023Quote: ... 2 mL of supernatant containing viral particles was harvested and filtered with 0.45 μm filter (Merck). Supernatant was immediately used for transduction or stored at -80°C in aliquots.
-
bioRxiv - Microbiology 2024Quote: One mL of culture broth was mixed in a 2:1 ratio with chloroform (Merck, Mumbai), followed by centrifugation (15,300 g ...
-
bioRxiv - Bioengineering 2022Quote: ... and LX-2 cells were labeled with a PKH67 Green Fluorescent Cell Linker Kit (Merck, PKH67GL) according to the manufacturer’s protocols ...