Labshake search
Citations for Merck :
701 - 750 of 3358 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 mL of Naphthol-AS-MX ALP solution (855, Merck KGaA).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Molecular Biology 2021Quote: ... grids were colored with aqueous 2% (w/v) uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Biochemistry 2020Quote: Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) was transformed with pET28a-His6-CrTRXz and grown in 1 L of 2YT medium supplemented with kanamycin (50 µg.mL-1 ...
-
bioRxiv - Immunology 2021Quote: ... 2 was further separated on RP-C18 F254s preparative TLC plates (Merck) using a methanol-acetonitrile (1:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... CDK1/2 inhibitor III (called ‘Cdk1/2i’ in this study, Merck 217714), CHIR-99041 (called ‘GSK3i1’ in this study ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 mM Na3VO4,0.2 μM microcystin-LR and 10 mM 2-chloroacetamide (Merck)) as described previously (15).
-
bioRxiv - Molecular Biology 2021Quote: ... grids were colored with aqueous 2% (w/v) uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified HDRT was concentrated using Amicon Ultra-2 Centrifugal Filter Units (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were selected in puromycin (2.5 µg/mL; Merck 58-58-2) for 7 days.
-
bioRxiv - Pathology 2023Quote: ... 1 µl of 10x TCEP (Tris(2-carboxyethyl)phosphine hydrochloride (#C4706, Merck) was added to the lid and mixed carefully ...
-
bioRxiv - Neuroscience 2023Quote: ... and the nuclear stain Hoechst 33258 (2 ug/mL, Sigma-Aldrich, Merck) for 2 h at RT ...
-
bioRxiv - Physiology 2022Quote: ... SFM was replaced with SFM containing 2 % bovine serum albumin (BSA) (Merck). To stimulate the βARs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The second plaque slice was preserved in 2% PFA (8.18715.1000, Merck Millipore) and used for optical tissue clearing.
-
bioRxiv - Bioengineering 2023Quote: ... 2 dpf embryos were manually dechorionated and anesthetized with MS-222 (Merck). 4 nl of the sample were delivered into the common cardinal vein using microcapillaries (TW100-4 ...
-
bioRxiv - Genetics 2024Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100 µL of 2 mg/mL sulfo-sanpah (Sigma-Aldrich/Merck) was added only onto PAA gels ...
-
bioRxiv - Cell Biology 2023Quote: ... released for 2 h and treated with 100 ng/ml nocodazole (Merck) for 16 - 17 h ...
-
bioRxiv - Biochemistry 2023Quote: ... grids were washed with aqueous 2% w/vol uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated in 2% uranyl acetate (Sigma-Aldrich, Merck, Darmstadt, Germany) for 90 minutes at RT on a specimen rotator ...
-
bioRxiv - Evolutionary Biology 2024Quote: Spermathecae samples were fixed in mixture of 2% paraformaldehyde (Merck, Darmstadt, Germany), 2% glutaraldehyde (Agar Scientific ...
-
bioRxiv - Microbiology 2024Quote: Collected bone marrow was homogenized in 2 ml sterile 0.9% saline (Merck), diluted ...
-
Investigation of a Novel Mouse Model of Prader-Willi Syndrome with Invalidation of Necdin and Magel2bioRxiv - Systems Biology 2024Quote: ... mouse anti-neurophysin 2 clone PS38 (1:1000, Ref# MABN844, Merck Millipore), rabbit anti-GnRH (1:3,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... + 10% heat-inactivated Fetal Bovine Serum (Eurobio) + 2 mM L-Glutamine (Merck) + 1% Penicillin/Streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... anti-SARS-CoV-2-N mouse monoclonal antibody (ZMS1075; Merck, Darmstadt, Germany), anti-LAMP1 rabbit polyclonal antibody (9091T ...
-
bioRxiv - Molecular Biology 2024Quote: ... and carefully layered over 2 mL of 20% sucrose (Merck Millipore, USA) in polypropylene tubes (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.4 mM L-phenylalanine (Merck/Sigma-Aldrich, CAS number : 63-91-2),0.4 mM L-proline (Merck/Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... contrasted in 2 % (w/v) uranyl acetate (Sigma-Aldrich, Merck, Darmstadt, Germany) for 1.5 h at room temperature and washed once in distilled water followed by dehydration through a series of increasing ethanol concentrations (30% for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... suis antibody (1:100) and a mouse anti-tubulin beta III antibody (Merck Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspension in 9 ml of RPMI-1640 medium (Merck R0883). The digest was filtered through a 40 μm cell strainer to remove undigested tissue and the filtrate was centrifuged (300g for 10 min at 4°C) ...
-
bioRxiv - Cell Biology 2024Quote: ... Nocodazole (Cat # 31430-18-9) was obtained from Merck (Darmstadt, Germany). Antibodies for ERα (Cat # sc-543) ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were obtained from Novabiochem (Merck KGaA, Darmstadt, Germany). Peptides were purified using reverse phase preparative high-performance liquid chromatography (HPLC ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were purchased from Novabiochem (Merck KGaA, Darmstadt, Germany). N ...
-
bioRxiv - Developmental Biology 2023Quote: ... or N-Butyl phosphate (NBP, mixture of mono-N-Butyl phosphate and di-N-Butyl phosphate) of >95% purity (808555, Merck), were prepared by diluting in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Cell Biology 2020Quote: ... then electroblotted onto Immobilon-P membranes (Merck Millipore). Following blocking in 5% dried skimmed milk (Marvel ...
-
bioRxiv - Immunology 2021Quote: ... transferred onto PVDF membrane (Hybond P, Merck Millipore), blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000 ...
-
bioRxiv - Immunology 2023Quote: ... and 1X Penicillin-Streptomycin (P/S) (Merck Millipore) (AdDF+++) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% Nonidet P-40 (NP40) (Merck (Sigma-Aldrich), Germany) ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... plates were washed with PBS and developed with H2O2 and o-phenylenediamine (OPD; Merck-Sigma). The Optical Density (OD ...