Labshake search
Citations for Merck :
6101 - 6150 of 6398 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTniQ was concentrated to 10 mg mL−1 using 10,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Microbiology 2022Quote: ... The membranes were blocked and incubated with primary antibodies against bornavirus P (1:500) and α-tubulin (Merck, Darmstadt, Germany), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2022Quote: ... For the valine-labeled sample ketoisovalerate was added to a final concentration of 40 mg L-1 together with deuterated leucine (Merck) to a final concentration of 25 mg L-1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... permeabilized for 30 minutes at room temperature in PBS supplemented with 0.2% Triton X-100 and 1% Bovine Serum Albumin (BSA) and blocked for 30 minutes at room temperature in 10% donkey serum (all from Merck). Samples were stained overnight at 4°C with the primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Explants were cultured in 35 mm tissue culture dishes pre-coated with poly-L-lysine (20 µg/ml for 1 hr; Merck) and laminin (20 µg/ml for 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were permeabilized with 60µL/well of 0.1% Triton X-100 for 10 minutes and stained with 50µL/well of DAPI (1:2000 dilution, in 1x PBST) (Merck, Germany) for 10 min [40] ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... “treated” cultures were grown with the addition of 0.25 µg ml-1 mitomycin C (MMC) (Merck Life Sciences UK Ltd). Mycelial pellets from untreated and treated cultures were washed in 1x PBS before lysis and RNA purification using the RNEasy Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dialyzed samples were further concentrated to 10 mg mL-1 using Amicon® Ultra-15 Centrifugal Filter Unit (Merck Millipore). The final concentration of glycerol was adjusted to 50% (v/v% ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lipid extracts corresponding to 1 mg wet liver weight were applied onto HPTLC silica gel 60 plates (10 × 20 cm: Merck) and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v ...
-
bioRxiv - Plant Biology 2020Quote: ... The inoculum concentration was adjusted to 106 spores mL-1 and the resulting spore suspension was supplemented with 0.1 % of Tween 20 (Merck, UK) prior to inoculation in the field ...
-
bioRxiv - Microbiology 2021Quote: Ago2 RIPs were performed on TREx-BCBL-1 RTA cells using EZ-Magna RIP RNA binding Immunoprecipitation Kit (Merck millipore) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Whole kidneys were homogenised in 250 mM sucrose / 20 mM triethanolamine with protease inhibitors (1% Merck Protease Inhibitor Cocktail III). The homogenate was cleared of large debris by centrifugation at 4000 g for 15 mins at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mg of total protein at a 1 mg/ml concentration was incubated with 40 µl anti-FLAG-M2 affinity resin (Merck) (which had been blocked overnight with 1% BSA and 5 µl/ml ssDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... They were then incubated in 1 mL of filtered Sudan Black B working solution (0,036 % (w/v) Sudan Black B (Merck, 15928), 0.1 % phenol ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human melanoma cell lines WM35 and WM793B were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution (Merck, Darmstadt, Germany). For generation of conditioned melanoma media for immune cell inhibition experiments tryptophan (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... A was 1 mM ammonium formate pH 9 (for lincomycin detection, prepared by titration of formic acid 98–100%, Merck, Germany with ammonium hydroxide 28–30% ...
-
bioRxiv - Plant Biology 2021Quote: ... Each MS medium was made by adding 1 bag of MS salt mix (Nihon pharmaceutical CO., LTD.) into the proper volume of milli-Q (Merck) water ...
-
bioRxiv - Immunology 2020Quote: ... The sections were blocked in PBS containing 1% bovine serum albumin (BSA) for 1 h at RT and stained in blocking buffer containing primary antibody (anti-PP6C, Merck Millipore cat ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 2h incubation with Alexa Fluor-488 goat anti-rabbit IgG secondary antibody (1:500, A11008, Merck Millipore, MA). Slices were transferred to glass slides and covered with Fluoromount (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% BR + 20% goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Merck) in the blocking buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were washed three times with 0.1% PBST and incubated at RT for 1 hour with horseradish peroxidase-conjugated secondary antibody (Cat No. NA934, Merck Millipore) diluted 1:1,000 in 0.05% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Microbiology 2023Quote: ... binding of equine antibodies was detected by incubation for 1 hour with protein A conjugated to peroxidase (GE) and visualized with chemiluminescence reagent (ECL, Merck). Images were obtained with an Odyssey LI-COR instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... APTS-labelled glycans were prepared for xCGE-LIF in a 1:10 dilution in water (water for chromatography, LC-MS grade, Merck) and mixed with 1 µl GeneScan™ 500 LIZ™ dye Size Standard (1:50 dilution in HiDi™ Formamide ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2.2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The frozen cell pellet was homogenized in RIPA buffer (Fujifilm, Osaka, Japan) containing 1/100 (v/v) in a final volume of Protease Inhibitor Cocktail (Merck) for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) in 1× PBS for 20 min at room temperature and then incubated with the anti-ADAR antibody HPA051519 (Merck) diluted 1:200 with PBS for 12 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... The pre-adipocytes were plated in custom-made plates (Supp. Fig. 15b) and cultured in growth medium -low glucose (1g l-1) DMEM (Merck) supplemented with 10% FBS (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... the slices were washed three times with a blocking buffer containing 1% bovine serum albumin and 0.25% Triton-X in phosphate buffer saline (PBS) and then incubated with primary antibodies (anti-tyrosine hydroxylase, rabbit polyclonal, 1:1000, Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... 1[µg of total RNA from each of three independent experiments was digested with DNase I (Merck Ltd. Budapest, Hungary) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then washed three times with 1 x PBS and mounted using an antifade mounting media (Sigma-Aldrich/Merck). The images were captured using a Zeiss AXIO Observer.Z1 Inverted Fluorescence microscope (Zeiss) ...
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...