Labshake search
Citations for Becton, Dickinson and Company :
1151 - 1200 of 1509 citations for Mycoplasma Agar 15x100mm plate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... At 48h ATTO550+ve single cells were FACS sorted into 96-well plates (BD FACSAria Fusion cell sorter) and ...
-
bioRxiv - Systems Biology 2023Quote: ... Naïve T cells were activated with plate bound anti-CD3ε (5 µg/ml, clone: 145-2C11, BD Biosciences) and soluble anti-CD28 (0.5 µg/ml ...
-
bioRxiv - Immunology 2022Quote: ... 1×104 cells/well of early and late passage were seeded in 12-well culture plates (BD Falcon). Cell number and viability were examined each day in triplicate wells using trypan blue exclusion and cell proliferative assay (# Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50,000 AML cells were seeded in 200 µL complete media in 48 well non-TC plates (BD Falcon), and treated with varying doses (from 1 nM to 1 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... nanobodies were purified with a 96-wells HIS-TRAP plate or a Cobalt-NTA (Talon) column (BD Biosciences), eluting with a buffer containing 25 mM HEPES (pH 7.8) ...
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed again with PBS+Tween-20 0.05% followed by the addition of TMB substrate (BD, 555214). Plates were allowed to develop for 10-25 minutes before adding 1M H2SO4 stop solution ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Genetics 2024Quote: ... YPD plates were placed inside the BD Gaspak EZ anaerobe gas generating pouch system with indicator (BD 260683) after spotting and incubated for up to 7 days ...
-
bioRxiv - Immunology 2024Quote: ... and positive control cells were incubated in plates coated with anti-CD3 (1μg/ml) (clone HIT3a, BD Biosciences) or PHA (2 μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... C06/C20 microglia were cultured at 1 x 106 cells per well in 6-well plates (BD Falcon), and iMicroglia were cultured at 5 x 104 cells per well in 96-well plates (CellBind) ...
-
bioRxiv - Molecular Biology 2024Quote: ... single cells were sorted into a 96 wells plate by using a BD Influx cell sorter (BD Biosciences). Clones were grown until reaching enough cell numbers and genetic knockouts were identified by PCR amplification ...
-
Langerhans cells regulate immunity in adulthood by regulating postnatal dermal lymphatic developmentbioRxiv - Immunology 2024Quote: Sorted LCs were cultured with 3 x 104 cells per well in 96-well plate (BD falcon, #353072) for 2 days ...
-
bioRxiv - Biochemistry 2024Quote: ... Resuspended cells were transferred in 200 µl aliquots to a flat-bottomed 96-well imaging plate (BD Falcon). For every yeast strain measured ...
-
bioRxiv - Biochemistry 2024Quote: ... Resuspended cells were transferred in 200 µl aliquots to a flat-bottomed 96-well imaging plate (BD Falcon). For every yeast strain measured ...
-
bioRxiv - Bioengineering 2024Quote: ... and single mCherry+ cells were sorted into four 96-well plates per sample using the FACSAria Fusion (BD). Single cell colonies were expanded for two weeks until >50% confluent ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Liquid from each well of the plate was then individually passed through a 40um nylon screen (BD Falcon) and 2 mL of chilled R-90 was added to the resulting cell suspension ...
-
bioRxiv - Developmental Biology 2024Quote: ... in feeder free conditions on 6 well plates coated with 1:100 Matrigel (BD Bioscience, San Jose, CA) in 1X PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37 °C in anaerobic chambers with GasPak™ EZ Gas Generating Container System (BD Diagnostics) to maintain the anaerobic condition during the incubation for indicated time points ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 batches of 24 eggs each were placed in wells of 6-well plates (Falcon, BD Biosciences, Allschwil, Switzerland). Ten mL of diluted milt of 2 males each was prepared such that each male was represented with the same concentration of active sperm (25 Mio/mL ...
-
bioRxiv - Immunology 2020Quote: ... CD19+ Pf+ or HA+ B cells were single cell–sorted into 96-well plates using a FACSAria II (BD). Index sorting was used to determine isotype and B cell subsets by IgM ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed with PBS prior to the addition of 100 μL/well TMB substrate (BD Biosciences). Fifteen minutes after the addition of substrate ...
-
bioRxiv - Microbiology 2022Quote: ... They were cultivated on PDA plates at 25°C for growth and in potato dextrose broth (BD Difco™) culture for genomic DNA extraction as previously reported41 ...
-
bioRxiv - Cancer Biology 2021Quote: ... isolated GSCs or GSCs expressing shHAUSP were cultured on plates or coverslips pretreated with the Matrigel (354230; BD Biosciences) and induced for differentiation in serum-containing medium (1% FBS in DME ...
-
bioRxiv - Cell Biology 2022Quote: ... The sorting into 384-well plates was performed with a 100 µm nozzle on BD FACS AriaIII CellSorter (BD BioScience Flow Cytometry System equipped with four lasers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the transwell inserts from the CIM plates were coated with 20 μl of growth-factor-reduced Matrigel (BD Biosciences), at a concentration of 250 μg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... The bone marrow cells were plated onto a 100 mm culture dis h or six-well plate (BD Biosciences) coated with 0.01% poly-D-lysine and cultured in DME M supplemented with 1% penicillin/streptomycin and 10% FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... to prevent coagulation and was immediately placed in a 150mm plate containing 5-10ml RBC lysis buffer (BD Biosciences). After 10 min of lysis at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... viable cells were dispensed at different densities in 96-well plates by fluorescence-activated cell sorting (FACS Aria, BD). When required ...
-
bioRxiv - Immunology 2021Quote: ... Single cell sorting was done on 96-well plates using a FACS Aria II (BD Biosciences, Franklin Lakes, NJ) in the Biomedical Research Facilities Core at the University of Michigan.
-
bioRxiv - Molecular Biology 2021Quote: ... One single cell per well was seeded in 96-well plates using the BD Biosciences FACSAria II (BD Biosciences) apparatus ...
-
bioRxiv - Immunology 2021Quote: ... cells were resuspended in enzyme-free ethylenediaminetetraacetic acid (EDTA) buffer and replated in untreated 6-well plates (BD Falcon) at 1 M cells per well in unconditioned medium ±25 U/ml IFN-γ (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... single GFP-positive cells were sorted into 96-well plates using a DiVa fluorescence-activated cell sorter (BD Biosciences) at the Duke Cancer Institute Flow Cytometry Shared Resource ...
-
bioRxiv - Microbiology 2023Quote: ... T-cells were transferred to a 96 well plate after co-culturing and surface staining of CD8 (BD Biosciences) was performed ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were trypsinized and re-plated in 96-well plates at a density of 0.5 or 1 cell per well using a FACSAria Fusion instrument (BD) to obtain single cell clones ...
-
bioRxiv - Molecular Biology 2023Quote: ... a single bacterial colony from a freshly streaked plate was grown overnight at 37 °C in low salt LB medium (LS-LB: 1.0% bactotryptone (BD), 0.5% yeast extract (Alfa Aesar) ...
-
bioRxiv - Microbiology 2023Quote: ... and a batch of 30 96-deepwell plates were brought to the fluorescence activated cell sorter (FACS) (BD FACSJazz), and a restrictive gate based on FSC ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP-positive single cells were isolated and sorted into 96-well plates by FACS Aria cell sorter (BD Biosciences). Cells were maintained in 96-well plates until they reached confluence and then expanded into larger plates for further analysis ...
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells (1 × 105) were stimulated the plate-bound α-CD3 (1 μg/ml) (BD Pharmingen), α-CD28 (1 μg/ml ...
-
bioRxiv - Genomics 2023Quote: ... and single isolated nuclei (0.1% NP-40 substitute lysis buffer48 were sorted into 96-well plates using the BD FACSMelody and BD Fusion cell sorter ...