Labshake search
Citations for Lucigen :
51 - 100 of 759 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was extracted using the Masterpure Complete DNA Purification Kit (Lucigen-Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated DNA using the End-It DNA End-Repair Kit (Lucigen). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). A genotyping-by-sequencing protocol was modified from microsatellite library preparation and ddRAD sequencing approaches as follows (Nolte ...
-
bioRxiv - Microbiology 2019Quote: Total DNA was isolated using Masterpure Complete DNA Isolation kit (Epicentre). PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... genomic DNA was extracted using QuikExtract DNA reagent (Lucigen, Middleton, WI). Except where noted ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was isolated from obtained clones using DNA QuickExtract (Lucigen), the sgRNA-targeted sites PCR amplified and the products Sanger-sequenced ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Neuroscience 2022Quote: ... ChIP DNA was end-repaired (End-it DNA Repair kit; Epicentre) and A-tailed (Klenow Exo-minus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... phosphorylated DNA using the End-It DNA End-Repair Kit (Lucigen). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted (using MasterPure Yeast DNA Purification Kit; Epicentre, UK) from stationary phase and re-growth cultures for selected timepoints (Days 0 ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was extracted using the QuickExtract DNA extraction kit (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... DNA were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200). ChEC DNA was subjected to size selection using the Pippin Prep (SageScience ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was isolated using the MasterPure DNA Purification kit (Epicentre). We confirmed integrity of genomic DNA by gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using a MasterPure yeast DNA purification kit (Lucigen) according to manufacturer instructions using 10-50 million spores per microsporidia species ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the MasterPure Yeast DNA Purification kit (Epicentre) following the kit’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Neuroscience 2021Quote: ... Insert-DNA (50 ng) was ligated with vector-DNA (150 ng) using the Fast-Link DNA Ligation Kit (LK0750H, Lucigen). XL10-Gold ultracompetent cells were transformed with the ligation product and streaked out on agar plates containing Kanamycin ...
-
bioRxiv - Microbiology 2020Quote: The DNA isolation procedure and WGS procedure was performed as follows: DNA was extracted using the MasterPure DNA isolation kit (Lucigen) or MasterPure Gram Positive DNA purification kit (Lucigen) ...
-
bioRxiv - Microbiology 2020Quote: Total DNA was extracted using MasterPure™ Complete DNA Purification Kit (Epicentre). Total RNA was extracted using ExtractAll TRI-Reagent (Sigma Aldrich) ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, USA). Genomic PCR was performed using 100 ng genomic DNA ...
-
bioRxiv - Neuroscience 2020Quote: DNA was lysed with 50 μl QuickExtract™ DNA Extraction Solution (Lucigen). Copy numbers were analyzed by quantitative real-time PCR performed in an ABI Prism 7900 HT Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Systems Biology 2021Quote: ... genomic DNA was extracted using the MasterPure Complete DNA purification Kit (Lucigen) and sequencing libraries made by both the Nextera XT (FC-131-1024 ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Epicentre, QE09050). Genomic PCR was carried out using Q5® High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: Genomic DNA was isolated with the MasterPure Yeast DNA Purification Kit (Lucigen). This gDNA was digested with XhoI (Nippon Genetics ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from cells using the QuickExtract DNA Extraction Solution (Lucigen) and sequencing was performed with 110x coverage using 100 base pair paired end read lengths ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Lucigen). FLO11 was amplified with Phusion polymerase (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 1 1l genomic DNA in QuickExtract DNA Extraction Solution (Lucigen). After droplet generation with the QX200 Droplet generator (Biorad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA for genotyping was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) from harvested yolk sac tissue if available or else from a micro-dissected nick of the extraembryonic anterior proximal region ...
-
bioRxiv - Genomics 2020Quote: ... we extracted genomic DNA using Master Pure genomic DNA extraction Kit (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted from one plate using QuickExtract DNA extraction solution (Epicentre) to perform genotyping by PCR using primer pairs specifically recognizing the mutated sequences introduced by the ssODN and a genomic sequence adjacent to the region of integration ...
-
bioRxiv - Molecular Biology 2022Quote: ... and DNA was extracted with a MasterPure Yeast DNA Purification Kit (Lucigen). Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120 ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was extracted with the MasterPure Yeast DNA Purification Kit (Lucigen) and DNA concentrations were measured using the Qubit Flex fluorometer and 1x HS dsDNA assay kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) and 1 μl (qsp ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted using the MasterPure Yeast DNA purification kit (Epicentre, MPY80200), and concentrations were measured by Qubit ...
-
bioRxiv - Genetics 2023Quote: ... and genomic DNA was extracted using QuickExtract DNA Extraction Solution (QE09050; Epicentre) following the protocol recommended in the Alt-R genomic editing detection kit (1075931 ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted from each clone using QuickExtract DNA solution (Lucigen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Genomic DNA was isolated with the QuickExtract DNA Extraction Solution (Lucigen, QE09050), and correct PAX6 integration of the appropriate FT construct was confirmed by PCR ...
-
bioRxiv - Genomics 2022Quote: ... genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). An Illumina sequencing library was prepared using home-made Tn5 transposase as previously described (Tao et al ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted from clones using QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extraction was performed using QuickExtract™ DNA Extraction Solution (Lucigen), and the genomic locus of interest was amplified using AmpliTaq Gold® 360 Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA was collected using QuickExtract DNA extraction solution (Lucigen, #QE09050). The region surrounding the targeted site was PCR-amplified (F ...