Labshake search
Citations for Lucigen :
51 - 100 of 386 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen) was performed according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... gDNA was extracted using the DNA QuickExtract Solution (Lucigen), followed by PCR and Sanger sequencing to determine efficient mutation rescue.
-
bioRxiv - Biochemistry 2023Quote: ... The CopyControl™ Fosmid autoinduction solution was from Lucigen Corporation (Middleton ...
-
bioRxiv - Biochemistry 2023Quote: ... tissues were lysed in MasterPure tissue lysis solution (EpiCentre) containing 0.2 mg/mL proteinase K (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ng of each sample were PCR amplified using the FailSafe PCR system with PreMix H (Lucigen). Southern blot-based detection of telomere PCR products was modified from previous protocols 48,49 ...
-
bioRxiv - Microbiology 2022Quote: ... was performed in a two-step barcoded PCR protocol using the FailSafe PCR PreMix (Lucigen, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification was carried out using Premix D mixture of the FailSafe™ PCR System (Epicentre, # FS99250). The following primers were used for this analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... Standard PCRs were performed using StartWarm HS-PCR Mix (A&A Biotechnology) or EconoTaq PLUS2X Master Mix (Lucigen). PCR products were analyzed with 1.5% agarose gel containing GelRed (Biotium ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria were recovered by centrifugation and pellets were flash frozen until resuspension in 40 μl of a 20 mg/ml proteinase K solution (Avantor®, Radnor, PA, USA) with 1 μl of undiluted Ready-Lyse Lysozyme solution (Lucigen®, Middlesex, UK), and lysis was allowed to proceed for 10 min in a shaking incubator at 37 °C and 600 rpm ...
-
bioRxiv - Genomics 2020Quote: ... Cells were then lysed with QuickExtract DNA Extraction Solution (Lucigen) and PCR-amplified using primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNAs were prepared using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... cellular genomic DNA was extracted using QuickExtract DNA solution (Epicentre) and the Gaac.1826 target locus was PCR amplified and purified using DNA Clean & Concentrator™ (Zymo Research ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen), depending on confluency 25 to 100 μl of solution was added to the wells containing the cells for 15 minutes at 37C ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Cell pellets were lysed using QuickExtract DNA Extraction Solution (Lucigen) following supplier’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... the cell pellet resuspended in 100μL QuickExtract solution (Lucigen #QE09050), transferred to PCR-tubes and incubated in a thermocycler for 15 minutes at 68°C ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Molecular Biology 2023Quote: ... gDNA was obtained by using QuickExtract DNA Extraction Solution (Lucigen), where 10000 cells were resuspended in 100 μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and genomic DNA was extracted using QuickExtract solution (Lucigen, QE0950).
-
bioRxiv - Microbiology 2023Quote: ... 50 U/μL Ready-Lyse Lysozyme Solution (Lucigen, WI, USA), 2 U/mL Zymolyase (Zymo Research Corporation ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA was extracted with QuickExtract DNA Extraction Solution (Lucigen#QE09050). For each reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... 20 µL of QuickExtract DNA Extraction Solution (Epicentre Cat. # QE09050) (prewarmed to 65°C ...
-
bioRxiv - Bioengineering 2024Quote: Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre). Target regions were amplified by PCR with HOT FIREPol® DNA Polymerase (Solis BioDyne ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cells were lysed in a Ready-Lyse lysozyme solution (Epicentre Technologies) according to manufacturer’s instructions and lysates were homogenized through QiaShredder columns (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and gDNA was extracted by using QuickExtract DNA Extraction solution (Epicentre) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Physiology 2022Quote: ... sorted (eGFP+) cells was extracted using QuickExtract DNA Extraction Solution (Lucigen). EnGen Mutation Detection Kit (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were removed by precipitation with MCP solution (Lucigen, WI, USA) and the supernatant was collected after centrifugation at 17,000 x g for 10 min at 40C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA extraction was done using QuickExtract DNA Extraction Solution (Epicentre, #E09050) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and the region of interest was amplified by PCR using Phusion High Fidelity DNA Polymerase (Thermo Fisher) ...
-
bioRxiv - Genetics 2024Quote: ... media aspirated and 30uL of QuickExtract™ DNA Extraction Solution (Lucigen) added to the wells ...
-
bioRxiv - Immunology 2024Quote: ... genomic DNA extracted (QuickExtract™ DNA Extraction Solution, Lucigen, cat. QE09050) and the remainder restimulated with fresh medium and cultured for an additional 14 days (Jones et al. ...