Labshake search
Citations for Lucigen :
701 - 750 of 750 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were maintained under regular media exchange until reaching ∼90% confluency when editing was analyzed by extracting genomic DNA using QuickExtract (Lucigen).
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... and four CS (line 403 subclones 1, S7, S8, and S9) iPSC lines was extracted using quick extract DNA extraction solution (Epicentre #QE09050), amplified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... the ligase-treated DNA was incubated with 2 μl (10 U/μl) of Plasmid-Safe ATP-Dependent DNase (Lucigen; Middleton, WI) in 1x reaction buffer (33 mM Tris-acetate ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 serial dilution samples and a non-evolved yLL132a ancestor with the MasterPure Yeast DNA Purification Kit (Epicentre, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The gDNA was isolated by using a MasterPure™ Complete DNA&RNA Purification Kit (Epicentre®, Illumina®, Madison, Wisconsin, USA) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... clones were genotyped using PCR primers outside of the gRNA targeted region (Table S6) to identify clones homozygous for the mariner deletion (DNA QuickExtract Lucigen #QE09050). Clones passing initial genotyping were then further expanded ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were washed once with DPBS and genomic DNA (gDNA) was extracted with 50 µL/well of Quick-Extract solution (Lucigen, QE09050). Lysates were pipetted up and down thoroughly ...
-
bioRxiv - Developmental Biology 2022Quote: ... shRNAs were synthesized by in vitro transcription (IVT) from double stranded DNA templates using the AmpliScribeTM T7-flashTM transcription kit (Lucigen, Inc.) and were purified using Direct-Zol TM RNA Miniprep kits (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... The suspension was spun down at 5,000 x g for 5 minutes and the pellet was resuspended in 100 µl of QuickExtract™ DNA Extraction Solution (Lucigen) and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre ...
-
bioRxiv - Neuroscience 2019Quote: ... The genotype of Tet2flox/flox;Cx3Cr1WT/WT and Tet2flox/flox;Cx3Cr1Cre/WT mice was determined by analysis of DNA extracted from the fingers using a QuickExtract™ (Epicentre) and amplified with MyTaq™ Red DNA Polymerase (Bioline) ...
-
bioRxiv - Neuroscience 2019Quote: ... The deletion of the Tet2 gene was determined by analysis of DNA extracted from isolated primary microglia using a QuickExtract™ (Epicentre) and amplified with MyTaq™ Red DNA Polymerase (Bioline).
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA from overnight saturated cultures of isogenic bacterial clones was prepared using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen) according to the manufacturer’s guidelines and sequenced at the Microbial Genome Sequencing Center (MiGS ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Crude genomic DNA was generated by incubating yeast isolates at 95°C in 50 μL of 20 mM NaOH for 10 minutes or the MasterPure™ Yeast DNA Purification Kit (Lucigen). PCR Tag analysis was performed either by adding 1.8 μL of yeast lysate used as template DNA to 6.25 μL of 2X GoTaq® Green Master Mix (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... Thirty thousand cells of each clone were added to 100 μL of Quick Extract™ DNA Extraction Solution (Lucigen, Wisconsin, USA). DNA was extracted by heat treatment (65°C for 6 min and 98°C for 2 min) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Fosmids from each hit were isolated by BioS&T (Quebec, Canada) or using the FosmidMAX™ DNA Purification Kit (Lucigen Corporation). Isolated fosmids were prepared for Illumina sequencing using the plexWell™ 96 kit (seqWell ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was isolated from yeast and contaminating DNA was depleted using the MasterPure Yeast RNA Purification Kit (Epicentre, Madison, WI) protocol with minor changes as previously described (Carrocci et al. ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Biochemistry 2022Quote: ... Clones with the best response to TMP were expanded and lysed for gDNA extraction and purification using the QuickExtract DNA extraction solution (Lucigen, Middleton, WI). Genomic ecDHFR was amplified (forward ...
-
bioRxiv - Neuroscience 2020Quote: ... The supernatants were used as DNA templates for polymerase chain reactions (PCRs, EconoTaq Plus Green 2X mater mix, Lucigen, Middleton, WI, USA). The genotyping primers were as described previously29,30,92
-
bioRxiv - Molecular Biology 2020Quote: The >200nt RNA fraction was ribo-depleted using non-overlapping DNA oligonucleotides that are complementary to rRNA 18s and 28s followed by digestion with Hybridase™ Thermostable RNaseH (Lucigen #H39500), as previously described (79) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 22 Alanine production plasmids were constructed using codon optimized (Codon Optimization Tool from the IDT) synthetic DNA and the pSMART-HCKan vector (Lucigen, Middleton, WI). Plasmids were assembled using NEBuilder® HiFi DNA Assembly Master Mix following manufacturer’s protocol (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The swabs were each placed in 1.5 mL Eppendorf tube containing 200 ul of QuickExtract DNA Extraction Solution (QE buffer, Lucigen LLC, Madison, WI). Each tube was vortexed and stored until extraction.
-
bioRxiv - Genomics 2022Quote: ... from at least two freshly starved 9 cm plates of the appropriate worm strain using the MasterPure Complete DNA and RNA Purification kit (Lucigen; cat. #MC85200), following manufacturer protocols ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA from edited and unedited HSPC samples was harvested 48h post-editing using QuickExtract DNA Extraction Solution according to manufacturer’s recommendations (Lucigen Corp., Teddington, UK) and diluted to 4.55 ng/uL in IDTE pH 8.0 (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... primer sets were screened against a synthetic TSV RNA target in vitro transcribed from gBlock™ DNA (IDT, Table S1) using the Ampliscribe T7-Flash Transcription kit (Lucigen Corporation) and purified using the RNA Clean and Concentrator kit (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was randomly sheared through a syringe needle and was end-repaired and cloned into pWEB::TNC (Epicentre Technologies, Madison, WI), followed by packaging into MaxPlax lambda packaging extracts ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was discarded and the pellet resuspended in 300 μl of lysis solution and 1 μl of RNase A from the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, US). The kit protocol was followed ...
-
bioRxiv - Neuroscience 2023Quote: ... The supernatants were used as DNA templates for polymerase chain reactions (PCRs, EconoTaq Plus Green 2X mater mix, Lucigen, Middleton, WI, USA). For embryonic genotyping during primary culture preparation ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA from fungal mycelium grown on SDA plates was extracted according to the manufacturer’s instructions (Epicentre, Madison, WI, USA, Cat. No. MC85200). Complete ITS1-5.8S-ITS2 (ITS ...
-
bioRxiv - Biochemistry 2020Quote: ... pNT-15 was constructed using NEB HiFi DNA Assembly with a gBlock® from IDT (Coralville, IA) and cloning vector pSMART-HCKan (Lucigen, #40704-2). All PCR reactions were performed with Q5® Hot-Start High Fidelity Master Mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA from the whole mosquito was isolated and purified using the MasterPure™ Gram Positive DNA Purification Kit following the manufacturer’s instructions (Epicentre Biotechnologies, Madison, USA). During DNA extraction ...
-
bioRxiv - Genomics 2022Quote: ... and split into 6-well culture for expansion and into lysis buffer for DNA extraction (homemade by GESC, formulation identical to Lucigen Quick-Extract buffer). PCRs were performed with Platinum Superfi II 2x master mix (Thermofisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA extraction was carried out by lysing the microbes in fresh frozen tissue samples using Yeast Cell Lysis Buffer (Epicentre, Madison, WI, USA) and bead beating ...
-
bioRxiv - Developmental Biology 2023Quote: The genomic DNA of individual control or Dll-KO embryos (sorted manually based on injection marker or on reporter expression) were extracted with 20 μl of Quick Extract ™ DNA Extraction Solution (Lucigen, Cat# QE09050) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
bioRxiv - Microbiology 2023Quote: ... Digested fragments were cloned into the BamHI/NcoI pre-digested pET15b plasmid using the Fast-Link™ DNA Ligation Kit (Epicentre, Madison, WI), and E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We extracted genomic DNA from overnight YPD cultures derived from each clone according to the manufacturer’s instructions (MasterPure™ Yeast DNA Purification Kit, Biosearch Technologies - Lucigen, Wisconsin, USA) and purified on Axygen™ AxyPrep Magnetic PCR Clean-up SPRI beads (Axygen Inc ...
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA from infected barley leaves at 6 days post-inoculation (dpi) was isolated by using the MasterPure™ Complete DNA&RNA purification Kit (Epicentre®, Illumina®) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Shot-gun library was generated at the McGill Genome Center using the NxSeq® AmpFREE Low DNA Library Kit Library Preparation Kit (Lucigen Corp., WI, USA) according to the manufacturer’s recommendations and the library was ran on a HiSeq X for 2×150 cycles.
-
bioRxiv - Microbiology 2022Quote: ... Swabs were incubated for one hour at 37°C with shaking in 300μL yeast cell lysis solution (from Lucigen MasterPure Yeast DNA Purification kit) and 10,000 units of ReadyLyse Lysozyme solution (Lucigen) ...