Labshake search
Citations for Agilent :
651 - 700 of 6656 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were detected by polyacrylamide gene electrophoresis or the Agilent DNA 1000 kit (Agilent Technologies Inc, Germany). Samples from the Innsbruck cohort and the remaining non-HPV16/18 samples from the Oslo cohort (n=40 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting fragments were cloned into the StrataClone TA-cloning vector and transformed into StrataClone SoloPack competent cells according to the manufacturer’s protocol (StrataClone PCR Cloning Kit, Agilent), resulting in pFF-162 (SpoY) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were assessed for purity and concentration on the Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies). Samples were multiplexed and sequenced on the Illumina HiSeq 2500 system (Genome Technology Core ...
-
bioRxiv - Bioengineering 2024Quote: ... Error-prone PCR reactions were carried out following the protocol provided by GeneMorph II Random Mutagenesis Kit (200550, Agilent). Primers were designed to flank residue 1 to 119 of the binder ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then blocked in the Peroxidase Blocking solution (Dako REAL, S2023) for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then blocked in the Peroxidase Blocking solution (Dako REAL, S2023) for 8 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The PCR reaction was performed using Brilliant PCR mix (Agilent Technologies, USA). The standard curve was drawn using serially diluted ΔintS genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the PCR product was subcloned into Strataclone blunt PCR vectors (Stratagene) and subcloned further into pCM V-ONCM to generate the pCMV-SS-ONCM construct ...
-
bioRxiv - Microbiology 2020Quote: ... Background correction and normalization was achieved using Iterative Plier 16 with GeneSpring V12.0 software (Agilent Technologies, Inc.). Probe set signals were calculated with the Iterative Plier 16 summarization algorithm ...
-
bioRxiv - Genetics 2021Quote: ... as well as a kinase-dead control (K396H) 16,were generated by single-site mutagenesis (Agilent 210518) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... OD600 was measured every 15 min for 16 h using a Biotek Synergy HTX plate reader (Agilent). Vmax and area under the curve (AUC ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by colourimetric detection by diaminobenzidine substrate (Dako, Santa Clara, CA, USA, #K3468). Following this ...
-
bioRxiv - Plant Biology 2020Quote: ... (2017) using reversed phase HPLC separation coupled to diode array detection (Agilent Technologies). Dehulled grain was ground and resulting flour samples (20 mg ...
-
bioRxiv - Cancer Biology 2020Quote: ... The antibody was detected using Dako EnVision Detection System Peroxidase/DAB (Dako, #K5007). Definiens Tissue Studio software was used to quantify the staining ...
-
bioRxiv - Genetics 2022Quote: ... Immunohistochemical stainings were done using the EnVision-Detection System/HRP (Dako, Glostrup, Denmark), followed by 3,3-diaminobenzidine (DAB+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of IRF4 employed the monoclonal antibody MUM1P (M725929; DAKO/Agilent, Waldbronn, Germany).
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of IRF4 employed the monoclonal antibody MUM1P (M725929; DAKO/Agilent, Waldbronn, Germany).
-
bioRxiv - Bioengineering 2023Quote: ... and then transferred to a universal microplate reader for bioluminescence detection(Cytation1, Agilent). Based on the LDH method for evaluating killing efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantification was made using gas chromatography with flame ionization detection (Agilent Technologies, 6890) fitted with a low polarity column (Rxi-5HT ...
-
bioRxiv - Microbiology 2023Quote: ... For signal detection the samples were incubated with horseradish peroxidase-labelled streptavidin (Dako, Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Dako). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Microbiology 2019Quote: ... a 10 min incubation at room temperature (RT) with peroxidase blocking buffer (Dako) and a 30 min incubation at RT with Envision+System HRP Rabbit (Dako) ...
-
bioRxiv - Neuroscience 2021Quote: ... The RT reaction was performed using a thermal cycler (Agilent Technologies, Stratagene Mx3000P) with the following parameters ...
-
bioRxiv - Neuroscience 2021Quote: ... The RT reaction was performed using a thermal cycler (Agilent Technologies, Stratagene Mx3000P) with the following parameters ...
-
bioRxiv - Microbiology 2021Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was used for RT-qPCR with miRNA QPCR Master Mix (Agilent Technologies). Universal reverse primers (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent). The reaction was visualized with diaminobenzidin (DAB ...
-
bioRxiv - Systems Biology 2022Quote: ... for migration time and then injected into a capillary electrophoresis time-of-flight mass spectrometry system (Agilent Technologies, Santa Clara, CA, USA) (27–29) ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2021Quote: ... coupled to time of flight mass spectrometry (6224 Agilent) (CE-TOF-MS ...
-
bioRxiv - Cell Biology 2021Quote: ... Hsc70D10N was generated by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Cyclin D1 KO was conducted by CRISPR/Cas9 genome editing (Xie et al. ...
-
bioRxiv - Cell Biology 2020Quote: A library encoding ARHGAP36 isoform 2 mutants was created via error-prone PCR (epPCR) using the GeneMorph II Random Mutagenesis Kit (Agilent). To determine the optimal epPCR conditions for library generation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA probes were synthetized by cloning the DNA amplified region in the Strataclone PCR Cloning Kit (240205-5, Agilent Technologies) (hoxd12a ...
-
bioRxiv - Genomics 2020Quote: ... the amplified libraries were purified using a Qiagen MinElute PCR Purification Kit and eluted in 20 μl Elution Buffer before quantitation on an Agilent 4200 TapeStation (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Developmental Biology 2019Quote: Pkin-29::kin-29SER517ALA was generated by modifying Pkin-29::kin-29cDNA using PCR-based mutagenesis (Quickchange II XL site-directed mutagenesis kit, Stratagene). The following primers were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... the gene of FASTD71V,P73T was randomly mutagenized by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent). The PCR product was digested with NheI and BamHI ...
-
bioRxiv - Cell Biology 2019Quote: ... Single-point mutants in PACRG were generated by PCR mutagenesis using the QuickChange II Site Directed Mutagenesis kit (Agilent Technologies). The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397 ...
-
bioRxiv - Biochemistry 2020Quote: ... The error-prone PCR (epPCR) library of the gene encoding qmLC/A was created with the GeneMorph II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: Mutations were generated in previously-described single-round plasmid derivatives of HIV-1NL4-3 (pNLdE-luc)48 and HIV-1LAI (pBru3ori-ΔEnv-luc2)49 that encoded for luciferase via the QuikChange site-directed PCR mutagenesis kit (Agilent). Resulting plasmid DNAs were verified by Sanger sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Microbiology 2019Quote: ... We used pMotB.com plasmid as the PCR template for these substitutions using a site-directed mutagenesis kit (QuikChange, Stratagene Inc.) yielding plasmids MotB(D24E ...
-
bioRxiv - Cancer Biology 2019Quote: Both types of libraries ligation products were enriched with 15 PCR cycles and the final library was validated on an Agilent 2100 Bioanalyzer with the Agilent DNA 1000 Kit (Agilent).
-
bioRxiv - Genomics 2019Quote: ... a double-stranded DNA probe (obtained by PCR amplification using oligonucleotides AMO2002-2003) was 32P-labelled using the Prime-It II Random Primer Labeling Kit (Agilent), then hybridized overnight at 65°C in PerfectHyb™ Plus Hybridization Buffer (Sigma).
-
bioRxiv - Microbiology 2021Quote: All viral stocks were generated in Vero cells and tested negative for Mycoplasma contamination using a MycoSensor PCR Assay Kit (Agilent). Detailed passage histories of the ZIKV isolates used in this study were previously described (56) ...
-
bioRxiv - Cell Biology 2019Quote: ... Site-specific mutations of ACC2 and stop codon deletion constructs were performed using PCR-based mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent). The plasmids for C-terminus GST-tagged or Flag-tagged ACC2 fragments were re-cloned from the human ACC2 plasmid using PCR and Gibson assembly ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: The first yeast library (called library A in this study) of FAST constructed by error-prone PCR using Genemorph II kit (Agilent) was previously described23 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both Southern blot probes were generated by standard PCR and subjected to random labelling using a Prime-It II Random Primer Labelling Kit (#300385, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 67)) plasmid as PCR template Bri2 BRICHOS D148N was obtained with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, US), and the DNA sequence was confirmed (GATC Bioteq ...