Labshake search
Citations for Agilent :
651 - 700 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... we performed DNA shuffling75 followed by error-prone PCR (GeneMorph II Random Mutagenesis Kit, Agilent Technologies). The DNA shuffled and error-prone PCRed library is hereafter referred to as the “Shuffled Library.”
-
bioRxiv - Physiology 2021Quote: ... qPCR was performed using SYBR Green (Brilliant II SYBR Green qPCR Mastermix, Agilent Tech. CA, USA) in a Stratagene MX-3000P-qPCR System (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The non-phosphorylatable rlc1 sequences were generated by site-directed mutagenesis using QuikChange II mutagenesis (Stratagene) according to the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.4) at 0.35 mL/min with an high performance liquid chromatograph (1260 Infinity II, Agilent).
-
bioRxiv - Pathology 2021Quote: The avrE-yy mutation was made using the QuickChange II site-directed mutagenesis kit (Agilent Technologies). pENTR/D-TOPO:avrE was used as a template for quick change PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... an AfeI site was introduced by site-directed mutagenesis using the QuikChange II XL kit (Agilent) and oligos RU-O-22971 and RU-O-22972 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1µL of genomic DNA was used for PCR amplification using PfuUltra II Fusion DNA Polymerase (Agilent) (for primers see Table supplement 2 ...
-
bioRxiv - Cancer Biology 2019Quote: Wobble mutant cell lines were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c ...
-
bioRxiv - Genetics 2020Quote: ... and p.I528V) were introduced by using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). NT5C2 recombinant protein production and purification were performed using previously described methods [28] ...
-
bioRxiv - Immunology 2021Quote: ... - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... The αSyn K96R variant was generated using the Quick-Change II site-directed mutagenesis kit (Stratagene) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutagenesis reactions were performed with QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) following the manufacturer protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... proSP-C BRICHOS D105N was obtained with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, US), and the DNA sequence was confirmed (GATC Bioteq ...
-
bioRxiv - Biochemistry 2021Quote: ... in 2 mL headspace vials and analysed on an HPLC instrument (Agilent Technologies, 1260 Infinity II); peaks were identified using pure standards ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We generated mutant libraries of each gene via random mutagenesis with the Mutazyme II kit (Agilent), using 200ng of DNA template and eight cycles of mutagenic PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Quality assessment was performed using Bioanalyser eukaryiotic total RNA nano series II chip (Agilent #5067-1511) and all samples achieved a RNA integration number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations N74D and A77V were introduced using the QuikChange II site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR using Brilliant II SYBR® Green QPCR Master Mix (Agilent, Santa Clara, CA, USA) was outperformed on CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... All point mutations were introduced with a QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by sequencing ...
-
bioRxiv - Immunology 2021Quote: Antibody gene mutations were introduced by QuikChange II site directed mutagenesis kit (Agilent, Cat. No. 200524)
-
bioRxiv - Genetics 2021Quote: ... an in-out PCR was performed with Herculase II Fusion High-Fidelity DNA Polymerase (Agilent Technologies). The specific size of the PCR products was verified in 1% agarose gel ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Microbiology 2022Quote: ... all clonings in the suicide vector pSW7848T were performed using Herculase II fusion DNA polymerase (Agilent) for PCR amplification and the Gibson Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: Synthesized cDNA was then subjected to SMART PCR using Herculase II fusion DNA polymerase (Agilent Technologies) with a common forward primer (5Anchor1-FW1 ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants of each strain were speciated by high-performance liquid chromatography (HPCL) (Agilent Infinity II 1290) using a C18 column reverse- phase (130 Å ...
-
bioRxiv - Microbiology 2022Quote: ... Waters) on an Agilent 1290 Infinity II ultra-high performance liquid chromatography (UHPLC) system (Agilent Technologies) coupled with Bruker Impact II electrospray-ionization quadrupole time-of-flight (ESI-QTOF ...
-
bioRxiv - Molecular Biology 2023Quote: ... The protocol for large insertions provided by the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was followed to insert TOM20 or H2B in place of the TFAM gene TFAM-mScarlet_pWPXL plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Biochemistry 2023Quote: ... MIEG3 expression vectors containing IER5 mutations were generated by QuickChange II Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2023Quote: ... Additional rounds of site directed mutagenesis using the QuikChange XL II site directed mutagenesis kit (Agilent) were applied to create Ptch1 KR (ATT/LIN)-His ...
-
bioRxiv - Bioengineering 2023Quote: ... In silico assembly and de novo synthesis of transformation plasmids using pBluesript II KS (+) (Stratagene, USA) as the backbone vector was done in the Snapgene (software v ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Cell Biology 2022Quote: ... Chromatographic separation was performed on a 1290 Infinity II LC system (Agilent, Santa Clara, CA, USA) equipped with a C18 column (Zorbax RRHD Extend ...
-
bioRxiv - Bioengineering 2022Quote: The targeted loci were amplified from extracted genomic DNA by PCR using Herculase II polymerase (Agilent). PCR amplicons were sequenced using primers ∼200 bp from the expected cut site ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was run on an ultra−high performance liquid chromatography (Agilent 1290 Infinity II, UHPLC) system coupled with an quadrupole time of flight mass spectrometer (Agilent 6545 ...
-
bioRxiv - Bioengineering 2022Quote: The targeted loci were amplified from extracted genomic DNA by PCR using Herculase II polymerase (Agilent). The PCR primers included Illumina sequencing handles as well as replicate-specific barcodes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Ten μL of diluted extract was separated on a 1290 Infinity II LC system (Agilent Technologies) with a Zorbax Rapid Resolution HT C18 column (50 × 2.1 mm ...
-
bioRxiv - Microbiology 2023Quote: The samples were analysed using an Agilent 1290 Infinity II UHPLC (Agilent Technologies; Santa Clara, CA) equipped with an Agilent Poroshell 120 Phenyl Hexyl column (1.9 µm ...
-
bioRxiv - Biochemistry 2023Quote: ... B: 98% acetonitrile/0.1% FA in water) (1290 Infinity II LC system, Agilent Technologies, Waldbronn, Germany). The temperature within the customized LC system was kept at 0 °C to minimize the back exchange ...
-
bioRxiv - Cell Biology 2023Quote: The chromatographic apparatus consisted of the 1260 Infinity II series LC system (Agilent Technologies, CA, USA). The stationary phase of the high-resolution reversed phase LC was a Zorbax SB-C8 Zorbax SB-C8 rapid resolution HT 2.1 × 100 mm 1.8 µm p.s ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNAs were PCR amplified from the genomic DNA using Herculase II Fusion DNA Polymerase (Agilent Technologies) and the flanking primers (hGeCKO_F1 and hGeCKO_R1) ...
-
bioRxiv - Immunology 2024Quote: ... The cGAMP loading efficiency (>90%) was quantified via high-performance liquid chromatography (1260 Infinity II, Agilent).
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Cell Biology 2020Quote: ... quantified by performing PCR reaction using Brilliant II SYBR® Green QPCR Master Mix (Agilent Technologies, USA). The primer sequences for PCR analysis were as follows ...
-
bioRxiv - Physiology 2022Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The human KCNQ2 and human KCNQ3 constructs were fused with sequence of the enhanced YFP at the carboxyl-terminal end ...
-
bioRxiv - Neuroscience 2019Quote: ... pPBase-BRAFwt was generated with quick change II XL single nucleotide site directed mutagenesis kit from Agilent according to the manufacturer protocol ...
-
bioRxiv - Immunology 2020Quote: ... and was probed using dCTP-32P labeled probes made using the PrimeIT II kit (Agilent, cat. 300385) and Roche Quick Spin Columns (TE ...
-
bioRxiv - Cell Biology 2019Quote: The CH mutant was made from the CB construct by site-directed mutagenesis (Quikchange II XL, Agilent) (fwd ...
-
bioRxiv - Pathology 2019Quote: ... Sections were stained using the CSA II kit (Biotin-free catalysed signal amplification system; DAKO, Glostrup, Denmark) and 3,3’-diaminobenzidine (DAB) ...