Labshake search
Citations for Agilent :
451 - 500 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Catalytic mutants were generated by site directed mutagenesis (Agilent Quik Change II Mutagenesis Kit). Primers used ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.
-
bioRxiv - Genomics 2019Quote: ... and 0.25 μl (20 U/μl) of Herculase II fusion DNA polymerase (Agilent Technologies). The amplification profile consisted of an initial denaturation step (3 min at 95 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...
-
bioRxiv - Microbiology 2020Quote: ... All point mutations were made using Site Directed Mutagenesis QuikChange II Kit (Agilent; 200524).
-
bioRxiv - Microbiology 2021Quote: ... tig was amplified from purified OG1RF genomic DNA using Pfu Ultra II polymerase (Agilent), digested with BamHI-HF/NheI-HF ...
-
bioRxiv - Microbiology 2021Quote: ... Chromatographic separation was performed on an Agilent 1290 Infinity II LC System (Agilent Technologies) equipped with an Acquity UPLC BEH Amide column (2.1 × 30 mm ...
-
bioRxiv - Microbiology 2021Quote: ... The sample was separated using an Agilent 1290 Infinity II LC system (Agilent, Singapore) with a BEH C18 column (2.1 × 100 mm ...
-
bioRxiv - Immunology 2019Quote: ... Point mutations were generated using the QuickChange II site-directed mutagenesis kit (Agilent, 200523) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Mutations were made in the CREAX reporter using the Quickchange II Kit (Stratagene, 200518). Details of the mutations are shown in supplementary table 1 ...
-
bioRxiv - Genomics 2021Quote: ... 12.5 μL of 2x Brilliant II SYBR Green Master Mix with low ROX (Agilent), and 9.3 μL of nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Biophysics 2020Quote: ... All mutations were made by Quickchange II Site-Directed Mutagenesis (Agilent, Santa Clara, CA) followed by DNA sequencing of the full gene ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Microbiology 2020Quote: ... The high-fidelity Herculase II Fusion DNA Polymerase (Agilent, Santa Clara, CA, United States) was used for PCR amplification ...
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Immunology 2022Quote: ... Chromatographic separations were achieved on a 1290 Infinity II HPLC (Agilent Technologies, Waldbronn, Germany) equipped with a Poroshell 120 EC-C8 column (3.0 × 150 mm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was performed to create the FLOT2 G2A and FLOT2 Y163F mutants ...
-
bioRxiv - Neuroscience 2022Quote: ... ATG9A Y8A-EGFP was generated using site-directed mutagenesis (QuikChange II XL, Agilent Technologies) of ATG9A- EGFP ...
-
bioRxiv - Microbiology 2022Quote: ... alleles were amplified from purified OG1RF genomic DNA using Pfu Ultra II polymerase (Agilent), digested with BamHI-HF and NheI-HF ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR amplification (PFU Ultra II HS 2x master mix from Agilent, 600850-51) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: Metabolites were analyzed by an HPLC-Q-TOF (Agilent 1260 Infinity II/Agilent G6545B) in MS mode using positive ionization ...
-
bioRxiv - Synthetic Biology 2023Quote: Metabolites were analyzed by an HPLC-Q-TOF (Agilent 1260 Infinity II/Agilent G6545B) in MS mode using positive ionization ...
-
bioRxiv - Systems Biology 2022Quote: ... Each 50μL reaction consisted of 10μL of 5X Herculase II Reaction Buffer (Agilent #600675), 34.5μL of nuclease-free water ...
-
bioRxiv - Plant Biology 2023Quote: ... and Infinity II 1290 UHPLC coupled to a 6550 iFunnel QTof (Agilent Technologies, Inc.). Data analyses were performed using Spectrum Mill MS Proteomics Workbench (Rev B.06.00.201 ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis was performed with the QuikChange II Site-directed Mutagenesis kit (Agilent) and primers ML 4421/4422 to generate the TOPO-DrpAK42A vector ...
-
bioRxiv - Genomics 2023Quote: ... we first used the QuikChange II Site-directed mutagenesis kit (Agilent, cat. no. #200523) according to the manufacturer’s instructions to remove the 78 bp mitochondrial localization signal (MLS ...
-
bioRxiv - Biochemistry 2023Quote: ... The point mutation plasmids were generated using QuikChange II kit (Agilent, cat no. 200521) with corresponding primers ...
-
bioRxiv - Plant Biology 2023Quote: ... and Infinity II 1290 UHPLC coupled to a 6550 iFunnel QTof (Agilent Technologies, Inc.). Data analysis was performed with Mascot Distiller (v2.4.2.0 ...
-
bioRxiv - Bioengineering 2023Quote: ... Filtered samples (0.2 μm syringe filters) were used for HPLC measurements (Agilent Infinity II). Samples were separated on a C18 column (Agilent ZORBAX Eclipse Plus C18 ...
-
bioRxiv - Biophysics 2023Quote: ... All mutations were made by Quickchange II Site-Directed Mutagenesis (Agilent, Santa Clara #200523) followed by DNA sequencing of the full gene ...
-
bioRxiv - Biochemistry 2023Quote: ... All point mutations were generated using QuikChange II following the manufacturer’s instructions (Agilent, 200523).
-
bioRxiv - Plant Biology 2023Quote: ... The samples were analyzed using an UHPLC device (1290 Infinity II LC, Agilent Technologies) composed of an automatic sampler ...
-
bioRxiv - Microbiology 2023Quote: ... and K572R mutants using the QuikChange II site-Directed Mutagenesis Kit (Cat # 200521; Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Site-directed mutagenesis was performed using Quick Change II Site–Directed Mutagenesis Kit (Agilent) and primers listed in Supplementary Table 2 ...
-
bioRxiv - Plant Biology 2023Quote: ... coupled with an Infinity II 1260 HPLC system (Agilent Technologies, Santa Clara, CA, USA). To purify duckweed extracts ...
-
bioRxiv - Neuroscience 2023Quote: QuikChange II Site-Directed Mutagenesis Kit and Dako Fluorescence Mounting Medium were from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2023Quote: ... the reduced peptidoglycan was analyzed by 1290 Infinity II LC/MSD system (Agilent technologies) using Poroshell 120 EC-C18 column (3 x 150 mm ...
-
bioRxiv - Biophysics 2023Quote: ... Point mutations in respective CaV1.3 subsegments were then generated using Quikchange II kit (Agilent). We generate W357A and W718A ...
-
bioRxiv - Biochemistry 2023Quote: ... All mutagenesis PCR reactions were amplified using PfuUltra II Fusion HS DNA Polymerase (Agilent). The parental (template ...
-
bioRxiv - Cell Biology 2023Quote: ... Site directed mutagenesis was performed according to manufacturer’s instructions (QuickChange II, Agilent, 200523-12). Following the PCR reaction ...
-
bioRxiv - Immunology 2023Quote: ... Site-directed mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... The adapter-ligated DNA fragments were amplified with Herculase II Fusion DNA Polymerase (Agilent). Finally ...