Labshake search
Citations for Agilent :
551 - 600 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... MCM7 forward: CCCCTCTTTCTCCCATGCTG reverse: AGGCCCAGGCTAGAAGATGA) and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828).
-
bioRxiv - Biochemistry 2021Quote: ... and I1074Y were created using the QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene) using previously described protocols [50] ...
-
bioRxiv - Biochemistry 2021Quote: ... The pEYKBA plasmid was mutagenized by site-directed mutagenesis using the QuikChange II kit (Agilent) to create point mutations in the kinase domain of Bcr-Abl ...
-
bioRxiv - Cell Biology 2020Quote: ... were generated using site-directed mutagenesis with PfuUltra II Fusion polymerase (Agilent, Santa Clara, CA) (Supplementary File 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the exception of PfuUltra II Fusion HS DNA Polymerase that was procured from Stratagene, Sweden ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each 20 μL reaction was prepared using the Brilliant II SYBR Green QPCR system (Agilent) following the manufacturer’s guidelines with the primers listed in Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the UHPLC system used in this work was a 1290 Infinity II system from Agilent Technologies (Santa Clara ...
-
bioRxiv - Genetics 2020Quote: ... DNMT1 point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent), with the residue numerations based on the isoform 1 of DNMT1 that contains 1616 amino acids ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... We used the QuickChange II XL site-mutagenesis kit (from Agilent Technology, Santa Clara, CA) to substitute wild type sequence with the mutant sequence ...
-
bioRxiv - Molecular Biology 2022Quote: The ABE7.10 mutant library was generated with error prone PCR using GeneMorph II (Agilent #200550) in the high mutation rate condition as described in manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutant constructs were generated using site directed mutagenesis using PfuUltra II high fidelity polymerase (Agilent) and following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Point mutations were created using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with either the pBRA SP-Tlde1WT plasmid or Tlde1WT pET28b plasmid used as template ...
-
bioRxiv - Genetics 2022Quote: ... with appropriate primers (Table S9) and the Pfu Ultra II Fusion HS DNA (#600674, Agilent) polymerase ...
-
bioRxiv - Microbiology 2022Quote: The analysis of enzymatic reactions was performed on Infinity II 1260 Liquid Chromatography system (Agilent). Separation of the enzymatic reaction products occurred on YMC-Triart C18 column in 30 mM ammonium acetate buffer system (pH 4.3 ...
-
bioRxiv - Physiology 2022Quote: ... hIP3R3 and hIP3R1 were generated using Pfu Ultra II Hotstart 2X Master Mix (Agilent Technologies) and appropriate primers obtained from Integrated DNA Technologies (Table ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative qRT-PCR was performed with the Brilliant II SYBR Green QPCR Master Mix (Agilent). Primers were designed to amplify ∼150 bp product within the target genes ...
-
bioRxiv - Microbiology 2022Quote: ... and V3306F were introduced using the Quick-change II Site-Directed Mutagenesis Kit (Agilent, UK).
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the QuickChange II XL Site Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and the following primers ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were analyzed using HPLC system 1260 Infinity II (Agilent Technologies, Santa Clara, CA, USA) equipped with Kinetex C18 (50 mm x 2.1 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... Error-prone PCR was done using Mutazyme PCR from Genemorph II mutagenesis kit (Agilent Technologies) according to the manufacturer’s suggestions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Various point mutant plasmids were prepared using QuikChange II XL site-directed mutagenesis kit (Agilent). QIAprep spin miniprep kit was utilized to make recombinant plasmids following vendor’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Site-directed mutagenesis was achieved by using the “QuickChange II site-directed mutagenesis” kit (Agilent) according to the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: ... the PCR was performed in duplicate per ligation reaction using Herculase II reagents (Agilent Technologies). The parallel library preparations and PCR reactions were subsequently pooled for each reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate expression plasmids with FH variants using a QuikChange II kit (Agilent). Sanger sequencing was used to confirm sequence identity.
-
bioRxiv - Immunology 2023Quote: ... Approximately 3 µg of AC3 was injected into 1290 Infinity II UHPLC system (Agilent Technologies) containing a Premier CSH-C18 column (Waters Corporation) ...
-
bioRxiv - Microbiology 2023Quote: ... Mutants were generated by site directed mutagenesis using QuikChange II (Agilent, Santa Clara, CA, USA) and validated via Sanger sequencing (GeneWiz ...
-
bioRxiv - Microbiology 2023Quote: ... and qPCR was performed using the Brilliant II SYBR® Green QPCR master mix (Agilent). PCR primer sequences included XIAP (F ...
-
bioRxiv - Biochemistry 2023Quote: ... Individual point mutant clones were constructed using the Quikchange II site-directed mutagenesis kit (Agilent).
-
bioRxiv - Biochemistry 2022Quote: Point mutation H73Q was generated using the QuikChange II Site-directed mutagenesis kit from Agilent according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The selected nucleotide sequence was amplified by PCR using Herculase II Fusion Enzyme (Agilent, USA) with specific oligonucleotide primer pairs incorporating p15TV-L adapters ...
-
bioRxiv - Bioengineering 2023Quote: ... Compounds were identified with a refractive index detector (1260 Infinity II Refractive Index Detector, Agilent) at 50C ...
-
bioRxiv - Physiology 2023Quote: ... Error prone PCR mutagenesis was performed using the GeneMorph II Random mutagenesis kit (Agilent, Germany). Standard PCR reactions for cloning or site-mutagenesis were done using Herculase II Fusion polymerase (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40C and detected with an HPLC fluorescence detector (1260 Infinity II Fluorescence Detector, Agilent) at an excitation/emission spectra of 384/478 nm ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reactions were performed using a Pfu-Ultra II Fusion High Fidelity DNA Polymerase (Agilent). All sequences were verified using Sanger sequencing (Microsynth) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplification was carried out using Herculase II Fusion DNA Polymerase enzyme (Agilent Genomics, USA) with specific primers (Supplemental Table S1).
-
bioRxiv - Neuroscience 2023Quote: qRT-PCR reactions were performed using Brilliant II SYBR Green qPCR Master Mix (Agilent #600828) according to manufacturer instructions using a Light Cycler HT7900 (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Relevant mutations were introduced with the QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies) to generate vectors encoding R1446C/Y1503F ...
-
bioRxiv - Cell Biology 2023Quote: ... Myc-TRIM27 W184A/F186A/L189A was mutated with Quickchange II site-directed mutagenesis kit (Agilent). pDONR221-AZI2/NAP1 was synthesized by Invitrogen GeneArt services (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA fragment encoding Kif23 (NM_024245, nucleotides 866-1367) was cloned into pBluescript II SK (–) (Stratagene). Digoxigenin-labeled RNA probe was synthesized using DIG RNA labeling kit (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... site-directed mutagenesis using the QuikChange II XL kit (Agilent Technologies, Inc., Santa Clara, CA). For each targeted codon ...
-
bioRxiv - Genetics 2024Quote: ... site-directed mutagenesis was performed with the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) (primer sequences Supplemental Table 2) ...
-
bioRxiv - Cancer Biology 2023Quote: Each library preparation PCR reaction contained the following components: 1μl Herculase II Fusion Enzyme (Agilent), 2.5μl Deoxynucleotide (dNTP ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNAs were amplified and equipped with adapters using Herculase II Fusion DNA Polymerase (Agilent, #600677) for 25 cycles ...
-
bioRxiv - Immunology 2024Quote: PCR was carried out with an error-prone polymerase (Agilent, GeneMorph II Random Mutagenesis Kit) to create a randomly mutagenized GP38 library as previously described79.
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pEGFP-Dynamin 2.WT was constructed using a Quik Change II XL (Agilent) site-directed mutagenesis kit to change the GCC (alanine ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis was carried out using a QuickChange II site-directed mutagenesis Kit (Agilent) according to the manufacture’s recommendation ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed using a Pfu-Ultra II Fusion High Fidelity DNA Polymerase (Agilent), whereas Gibson Assembly was performed using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: Five microliters were injected into a 1290 Infinity II LC UHPLC system (Agilent, CA, USA) connected to either a 6550 Series or 6540 Series Q-TOF mass spectrometer (Agilent ...