Labshake search
Citations for Agilent :
401 - 450 of 1271 citations for CEACAM 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... with Agilent SureSelect XT Target Enrichment System and Human All Exon V5 capture baits (Agilent Technologies). Next generation sequencing was carried out using the Illumina NextSeq500 or HiSeq 2500 platform with 2×79-144 cycles by the OHSU Massively Parallel Sequencing Shared Resource to an average depth of 100X per library replicate ...
-
bioRxiv - Cancer Biology 2022Quote: We performed immunochemistry assays using mouse anti-human ki67 antibody (M7240, DAKO, 1/200 at pH9) in a series of paraffin-embedded tissue blocks of HGSOC ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Cell Biology 2022Quote: ... A1AT was immuno-detected using the primary rabbit polyclonal anti-human A1AT ab (A0012, Dako, Agilent) at a 1:1,000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... A1AT was immuno-detected using the primary rabbit polyclonal anti-human A1AT ab (A0012, Dako, Agilent) at a 1:1,000 dilution ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-human IgG4 (Nordic clone N315, Nordic MUbio) and rabbit anti-mouse-AP (D0314, Dako) were used as secondary antibodies and conjugate respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... the analysis was performed using one color SurePrint G3 Human GE 8×60k Microarrays (Agilent Technologies), and the data is available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress ...
-
bioRxiv - Molecular Biology 2022Quote: Human K560-GFP and squid K554-GFP constructs were purified from BL21-CodonPlus(DE3)-RIPL (Agilent) E ...
-
bioRxiv - Genetics 2022Quote: ... the library was constructed using SureSelect All Human Exon V7 (Agilent Technologies, Cedar Creek, TX, USA). The library was paired-end sequenced (2×100 bp ...
-
bioRxiv - Neuroscience 2023Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 megabase pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq 4,000 (sx75 base-pair paired-end configuration ...
-
bioRxiv - Microbiology 2023Quote: ... β-catenin was detected using an anti-human β-catenin antibody (1:1000) (Agilent Dako, USA). After three washes in 1X PBS – 0.3% Tween 20 ...
-
bioRxiv - Microbiology 2023Quote: ... β-catenin was detected using an anti-human β-catenin antibody (1:1000) (Agilent Dako, USA). After three washes in 1X PBS – 0.3% Tween 20 ...
-
bioRxiv - Cell Biology 2023Quote: ... we performed immunochemistry assays using mouse anti- human ki67 antibody (M7240, DAKO, 1/200 at pH9) in a series of paraffin-embedded tissue blocks of HGSOC ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using the Agilent SureSelect Human All Exon kit (Agilent Technologies, CA, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... the data of GSE9210 were based on the GPL887 Platforms (Agilent-012097 Human 1A Microarray (V2) G4110B ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Plant Biology 2019Quote: ... GC-separation was achieved on a HP-5 column (Agilent Technologies) using the following temperature gradient ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 5-Å column (Agilent, 25m x 0.25mm x 30μm). Hydrogen that evolved during the BPEC stabilization stage (see previous section ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were acquired on a Biotek Cytation 5 Multimode Reader (Agilent) with the same gains and exposure across all animals for each stain ...
-
bioRxiv - Systems Biology 2022Quote: ... and desalted via 5 μg C18 columns on an AssayMap (Agilent) following the standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... chamber slides were scanned with an automated microscope (Cytation 5, Agilent) with a 4x objective and filters for high-contrast brightfield and GFP fluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a carbohydrate column (4.6 × 150 mm, 5 μm, Agilent Technologies). The sugar concentrations were quantified according to a standard solution (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS ...
-
bioRxiv - Microbiology 2023Quote: ... We exported bacterial growth data from the software (Gen 5, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... using the Cytation 5 Cell Imaging Reader (Agilent BioTek, CA, USA). Lactate levels present in the samples were estimated from the standard curve.
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Genomics 2020Quote: ... miRNA expression was measured using the Human miRNA Microarray Slide (Release 19.0) with Design ID 046064 (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... The following primary antibodies against various human differentiation antigens were used: vimentin (V9, M0725, Dako, Glostrup, Denmark), albumin (Dako ...
-
bioRxiv - Physiology 2020Quote: ... and then incubated with polyclonal rabbit antibody raised against human von Willebrand Factor (1:500; A0082, Dako), at 4°C overnight ...
-
bioRxiv - Bioengineering 2019Quote: ... Hydrogels were incubated in a 1:100 dilution mouse anti-human CD31 primary antibody (Agilent IS61030-2) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies used were: mouse anti-human CD8 (Dako, clone C8/144B, 1:800, pH 9 retrieval), mouse anti-human CD68 (Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA was isolated from human normal and tumor tissues according to manufacture protocol (Agilent Cat#400800), and the quantity and quality were confirmed by NanoDrop 2000C spectrophotometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Incubation with primary antibodies: mouse anti-human pan-Cytokeratin (1:50; clone A1/A3; Dako, Hamburg, Germany), rat anti-mouse CD31 (1:200 ...
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Cancer Biology 2020Quote: Sections were stained with mouse or rabbit anti-human monoclonal antibodies against CD20 (Dako, L26, 1:200), CD21 (DAKO ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...
-
bioRxiv - Immunology 2022Quote: ... anti-human IgG was diluted 1:1000 in assay buffer and Cy3-rabbit antihuman IgG (Dako Cytomation) by incubation for 2 h at room temperature according to the manufacturer’ ss recommendations ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...