Labshake search
Citations for Agilent :
351 - 400 of 1271 citations for CEACAM 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by polyclonal Rabbit anti-human Glucagon (cat. A0565, Agilent Technologies, Santa Clara, CA, USA) diluted 1:500 in PBS 1X supplemented with 3% BSA ...
-
Reprogramming enriches for somatic cell clones with small scale mutations in cancer-associated genesbioRxiv - Genomics 2020Quote: ... Exomes were enriched using the commercially available Agilent SureSelectXT2 Human All Exon v4 (Agilent Technologies). 2µg of gDNA (> 3*105 cells ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Genomics 2019Quote: ... and the Flex mouse anti-human CD31 antibody (clone JC70A, Dako North America, Carpinteria, CA) for 90 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies, CA). Samples were sequenced on Illumina HiSeq 1500 sequencer or NovaSeq 6000 platform ...
-
bioRxiv - Biochemistry 2022Quote: ... coupled to a depletion column (human 14 multiple affinity removal column; 4.6 × 50 mm; Agilent) according to the manufacturer’s procedure ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-exome libraries were prepared using a SureSelectXT Human All Exon V5 kit (Agilent Technologies). The RNA seq library from tumor RNA was prepared using Illumina TruSeq Stranded mRNA Library Prep Kit as per the manufacturer’s instruction ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: OCR in human liver cells was measured using XFp Extracellular Flux Analyzers (Agilent Seahorse Biosciences). The cells were plated into XFp cell culture mini plates for 24 h ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were generated using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Immunology 2019Quote: ... and used as hybridization probe on Whole Human Genome Microarrays (Agilent Technologies, Palo Alto, CA). Only probes with signal values >60% quantile in at least one condition were considered for the differential gene expression (DGE ...
-
bioRxiv - Neuroscience 2021Quote: ... CD20 (monoclonal mouse – anti-human CD20 IgG2a, clone L26, cat. no. M075501-2, Agilent Technologies), 1:800 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and enriched with the human kinome DNA capture baits (Agilent Technologies, Santa Clara, CA, USA). Six libraries were pooled for each capture reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 ng of genomic DNA from the test samples and human reference DNA (Agilent Technologies) were differentially labeled with Cy5-dCTP and Cy3-dCTP by random priming ...
-
bioRxiv - Biochemistry 2023Quote: ... genomic DNA libraries were prepared using the SureSelect Human All Exon V6 kit (Agilent Technologies). Exome libraries were subjected to next generation sequencing using DNBseq platform (MGI ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the SureSelect XT HS Human All Exon V7 target-enrichment probes (5191-4028, Agilent) for exome capture ...
-
bioRxiv - Genetics 2023Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... Immunodetection of TTR monomers was performed by employing rabbit anti-human TTR polyclonal antibody (Dako) as a primary and goat anti-rabbit antibody labelled with DyLight 680 (SERACARE ...
-
bioRxiv - Immunology 2024Quote: ... WES libraries were prepared using the SureSelect Human All Exon V8 Kit (Agilent; 5191-6873) and sequenced on either a NextSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries for whole-exome sequencing were prepared using the SureSelect Human All Exon V7 kit (Agilent) and the Illumina TruSeq Exome kit ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples are hybridized on the microarray slide (4×44K Human Genome CGH Microarray, Agilent Technologies). The slides were scanned using an Agilent dual laser DNA microarray scanner G2566AA ...
-
bioRxiv - Cell Biology 2020Quote: ... and prediluted polyclonal Guinea Pig anti-human Insulin (cat. IR002 - Agilent Technologies, Santa Clara, CA, USA) as second and third primary antibodies for 1h at room temperature (RT) ...
-
bioRxiv - Neuroscience 2020Quote: ... These data were obtained with Agilent SurePrint G3 Human GE v2 8×60K microarray (Agilent Technologies) from peripheral blood samples (all samples had RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2021Quote: The sequencing libraries were prepared and captured using SureSelect Human All Exon V4 kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... whole-exome DNA was capture using the SureSelect Human All Exon Kit V5 or V6 (Agilent) and high-throughput sequencing was conducted using the Illumina X10 with a coverage more than 100 X ...
-
bioRxiv - Genomics 2020Quote: ... LECs were washed twice in DPBS and stained with mouse anti-human Ki-67 antibody (Dako) diluted 1:800 in FACS buffer (DPBS with 1mM EDTA and 2% FBS ...
-
bioRxiv - Systems Biology 2019Quote: ... plasma samples were assayed using quantitative western blotting using a polyclonal antibody to human RBP4 (Dako) and human TTR (Dako ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tissue sections were incubated with primary antibodies to anti-human Ki-67 (Clone MIB-1, DAKO) and cleaved caspase-3 (Cell Signaling ...
-
bioRxiv - Genetics 2021Quote: ... with Agilent SureSelect XT Target Enrichment System and Human All Exon V5 capture baits (Agilent Technologies), following manufacturer’s protocols ...