Labshake search
Citations for Agilent :
351 - 400 of 3510 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Genetics 2019Quote: ... Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Microbiology 2019Quote: ... Spike-in RNAs were added to 100 ng total RNA using the One-color RNA Spike-In kit (Agilent Technologies) and Cy3-labeled cRNAs were synthesized using the Low Input Quick Amp Labeling kit (one-color ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA quality was assessed in one aliquot per extract using a Fragment Analyzer (Model CE12, Agilent Technologies, Santa Clara, USA), and samples with low RIN scores (<7 ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was amplified and Cy3 labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: One-step site directed mutagenesis was conducted on EhDHS1 and EhDHS2 gene by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies). Overlapping primers for site-directed mutagenesis were designed to replace phenylalanine at amino acid 302 of the pCOLD-EhDHS2 plasmid with lysine ...
-
bioRxiv - Pathology 2021Quote: ... Cyanine-3 (Cy3) labeled cRNA was prepared from 200 ng of total RNA using the One-Color Quick Amp Labeling kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Developmental Biology 2021Quote: ... Labeling and hybridization of the samples on the microarrays was performed according to the ‘One-Color Microarray-Based Gene Expression Analysis (Low-Input QuickAmp Labeling)’ protocol from the manufacturer (Agilent). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Gene expression profiling was performed using the Agilent protocol for One-Color Microarray Based Gene Expression Analysis Quick Amp Labeling v5.7 (Agilent Technologies). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Microbiology 2023Quote: ... One hundred microliters of the supernatant were transferred to an autosampler vial and analyzed by gas chromatography-mass spectrometry (Agilent 8890 Gas Chromatograph and Agilent 7000D Mass spectrometer) ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested using a modified in-solution sample preparation protocol.94 One hundred micrograms of desalted peptides were fractioned on an microflow HPLC (1260, Agilent) using a XBridge peptide BEH C18 column (130 Å ...
-
bioRxiv - Cell Biology 2024Quote: ... 90 µl of ATP reagent was added to each well and ATP-dependent bioluminescence (RLU1) was measured after one minute as relative light units (RLU) by Synergy H1 plate reader (BioTek, Agilent). Two wells without cells were used as a blank (RLU0) ...
-
bioRxiv - Microbiology 2024Quote: ... The E50A variant was further obtained by site-directed mutagenesis using an adapted protocol from the Stratagene “QuickChange” with only one mutator primer carrying the modified sequence and with both the Pfu turbo polymerase (Stratagene) and the Taq ligase (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was amplified and Cy3-labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: ... cyanine-3 (Cy3) labeled cRNA was prepared from 200 ng of total RNA using the One-Color Quick Amp Labeling kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: Gene expression analysis were performed with Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, AMADID 39494) with the following dual-color design ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA Integrity was ensured by obtaining an RNA Integrity Number - RIN >8 with Agilent 2100 Bioanalyzer (Agilent Technologies, Germany).
-
bioRxiv - Immunology 2022Quote: ... and the resulting peptides were captured and desalted by C-8 trap column (2.1 × 20 mm, Zorbax Eclipse XDB-C8 trap (Agilent) followed by loading on to C-18 column (2.1 × 50 mm in size ...
-
bioRxiv - Physiology 2020Quote: ... 20 μL samples were injected into Hi-Plex H column (300×7.7 mm; 8 μm particle size, Agilent Tech.). 0.1% formic acid in Milli-Q water (Merck Millipore ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: Day 30-50 iPSC-derived mDANs were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent) previously coated with Poly-L-ornithine and laminin ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: VIGS-treated barley RNA samples were verified for quality by a Bioanalyzer 2100 instrument and hybridized to the custom 8×16K microarray per the manufacturer’s protocol (Agilent). Sixteen total samples were hybridized ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...
-
bioRxiv - Immunology 2023Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8-10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and an Agilent 7693A autosampler fitted with a 100 μL gastight syringe was used to inject headspace gas (50 μL) into either a PoraPLOT Q capillary column (25 m, 0.25 mm ID, 8 μm film; Agilent) or a DB-VRX capillary column (20 m ...
-
bioRxiv - Cell Biology 2023Quote: ... was added and analyzed by LC-MS using a PLRP-S 1000A column (8 μm, 50 x 2.1 mm, Agilent) eluting with linear 20-60% ACN-water with constant TFA (0.05% ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody solution was then washed out 3x with TBS-T and TBS-T + 5% NFDM + 1:2000 Dako goat anti-rabbit or anti-mouse HRP-conjugated immunoglobulins (Agilent, Santa Clara, CA, USA) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).