Labshake search
Citations for Agilent :
501 - 550 of 3510 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... A 140 bp region of alpha satellite sequence from chromosome 4 and a 349 bp region of HSATII from chromosome 7 were independently cloned into pTargeT™ DNA backbone via StrataClone TA cloning (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: The rate of debenzylation of 7-benzyloxyquinoline was measured with a real-time continuous fluorometric assay using a Cary Eclipse fluorometer (Agilent Technologies, Santa Clara, CA, USA) or a custom-modified PTI QM-1 fluorometer (Photon Technology International ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Neuroscience 2020Quote: ... One microliter of sample was used to determine the concentration (Qubit 3.0 fluorometer) and integrity (Agilent 2100 Bioanalyzer, Agilent High Sensitivity DNA Kit). RNA sequencing was performed using the PE100 strategy (HiSeq 2500 ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA labeling and hybridization were performed by using the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent Technology, V 6.5, 2010). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... for a minimum of one month (De Guzman et al., 2016) before MRI using a 7.0 Tesla MRI scanner (Agilent Inc., Palo Alto, CA). Scanning was performed as in Misquitta et al ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... One microgram of purified cRNA was fragmented to uniform size and applied to Drosophila (V2) Gene Expression microarray (Agilent Technologies, Design ID 021791) in hybridization buffer ...
-
Physiological variation reflects bioclimatic differences in the Drosophila americana species complexbioRxiv - Evolutionary Biology 2019Quote: ... Each group of 20 flies was then lightly anesthetized and weighed as a group before being irradiated with UV-B light at one of the four experimental intensities using an ultraviolet Stratalinker 2000 (Stratagene, La Jolla, CA). For the 0J exposure - which essentially measures longevity in the absence of acute UV exposure - flies were simply anesthetized ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then transferred into a buffer storage solution of 0.1M PBS with 2mM ProHance and 0.02% sodium azide for a minimum of one month (De Guzman et al., 2016) using a 7.0 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) as in Anacker et al ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was assayed for purity and integrity using a NanoDrop One™ Spectrophotometer and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated with the conjugated antibody for one hour before being subjected to flow cytometry analysis on an ACEA NovoCyte Quanteon analyzer (Agilent, Santa Clara, CA). For xenograft TME cellular profiling and in vivo cancer cell HLA expression analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Cancer Biology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Biochemistry 2019Quote: ... cGAMP was purified from the crude reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Biochemistry 2019Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Immunology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene expression analysis was performed using an Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, Santa Clara, CA, USA) using an Agilent Single Color Labeling Kit (Low Input Quick Amp Labeling Kit 034949 ...
-
bioRxiv - Molecular Biology 2023Quote: ... seedlings were exposed on the plates to 8 kJ/m2 UV-C light in a Stratalinker 2400 (Stratagene, La Jolla, California, US) and transferred back into growth chamber for 5 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Immunology 2023Quote: ... the purity and integrity (threshold RNA Integrity Number >8) of isolated total RNA was determined by microfluidic spectrophotometry on the 2100 Bioanalyzer (Agilent Technologies, USA). RNA-seq libraries were generated via mRNA isolation from total RNA by polyA-positive selection using the TruSeq™ RNA/DNA Library Preparation Kit (Illumina #RS-122-2001 ...
-
bioRxiv - Genomics 2024Quote: Array-based comparative genomic hybridization (aCGH) was performed using SurePrint G3 Human CGH 8×60K microarrays (Agilent Technologies, Santa Clara, CA, USA) with 41 kb overall median probe spacing according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNA concentration (estimated by Nanophotometer NP80, Implen) and RNA integrity number (RIN > 8) were determined (by BioAnalyzer 2100, Agilent Technologies Inc.). RNA was sequenced (from nine RNA samples ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... RNA was amplified into cRNA and labeled according to the Agilent One-Color Microarray-Based Gene Expression Analysis Protocol (Agilent Technologies, Santa Clara, CA). The samples were hybridized to Rat GE 4×44K v3 array slides ...
-
bioRxiv - Immunology 2021Quote: cDNA was synthesized from the previously extracted RNA of mice colon tissue by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random 9mer primers ...
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity, Agilent, Santa Clara, CA, USA). Fully expanded mature leaves were punched from the middle position to collect leaf discs using a size 10 (2.54 cm2 leaf area ...
-
bioRxiv - Molecular Biology 2022Quote: ... amplified and labeled with Cyanine 3 (Cy3) as instructed by the manufacturer of the One-Color Agilent Low Input Quick Amp Labeling Kit (Agilent Technologies, Les Ulis, France). Cy3-labeled cRNA was hybridized onto Agilent Whole Human Genome Oligo 8×60K V2 Arrays (SurePrint G3 Human Gene Expression 8×60K v2 Microarray Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... labelled cRNA was prepared from 200 ng (mPFC/HT) or 40 ng (NAc) of total RNA using the One-Color Quick Amp Labelling kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... brains from 5-day-old flies of the appropriate genotypes were dissected and plated at one brain per well on XFe96 plates (Seahorse Bioscience, North Billerica, MA), and metabolic parameters were assayed as described (36 ...
-
bioRxiv - Biochemistry 2019Quote: ... solvent A) and methanol:isopropanol (8:2 v/v, solvent B) was generated by an Infinity II 1290 UPLC (Agilent, Santa Clara, CA, USA) and with a constant flow rate of 600 μL min−1 (0 min ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA fragments carrying both adapters after sodium bisulfite conversion were enriched by 8 cycles of PCR using the Pfu Turbo Cx Hotstart DNA Polymerase (Agilent, Santa Clara, CA). Primer dimers were subsequently removed using two rounds of purification using AMPure beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2019Quote: One-color microarray-based gene expression analysis was performed using a SurePrint G3 Human Gene Expression v3 8×60K Microarray Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The purity of RNA samples (RNA Integrity Number > 8) was confirmed using a Bioanalyser RNA Chip 2100 (Agilent Technologies, Santa Clara, CA, USA) and quantified using a Qubit 4 Fluorometer (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... All data were acquired on ~8-10 mg of lyophilized material using a 1.6-mm T3 HXY fastMAS probe (Agilent Technologies, Santa Clara, CA) with a magic-angle spinning (MAS ...
-
bioRxiv - Molecular Biology 2019Quote: ... and extracellular acidification rate (ECAR) in HKC-8 cells were studied by using a Seahorse XF24 Extracellular Flux Analyzer (Agilent, Santa Clara, CA). Key parameters of mitochondrial function were assessed by directly measuring the OCR in HKC-8 cells transfected with 40 nM of either miR-9-5p or miR-NC and treated with 10 ng/ml TGF-β1 for 48h ...
-
bioRxiv - Genomics 2020Quote: ... RNA quantity and purity were assessed using BioSpec Nano (Shimadzu, Kyoto, Japan) and RNA quality was validated (RNA integrity number > 8) using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). For Stage 1 ...
-
bioRxiv - Systems Biology 2022Quote: ... A total of 10×8 fields of view per well? are imaged with laser autofocus on the Cytation5 (Agilent Technologies, Inc., CA, USA). When reading was done ...