Labshake search
Citations for Agilent :
4751 - 4800 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... hFN10 containing a TAG stop codon at position 1493 was generated by PCR-based mutagenesis with the Quick-change kit (Agilent Technologies), cloned into bacterial expression plasmid pET11a and verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer protocol and purity as well as integrity controlled using the Agilent RNA 6000 nano kit (Agilent Technologies). RNA sequencing was performed on an Illumina NextSeq500™ platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single-cell RNA-seq libraries were prepared according to the manufacturer’s protocol and the library quality was confirmed with a Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627) and a Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: Ribonucleic acid was isolated from cells in indicated experimental conditions using a Qiagen miRNAeasy kit (Valencia, CA) and measured on an Agilent Bioanalyzer (Agilent Technologies). Illumina Novaseq 6000 libraries were prepared and sequenced by Novogene (CA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... pGEX(M)_cstK derivatives harboring different mutations were generated by using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), and resulted in the construction of plasmids detailed in Table 2 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The quantity and purity of the total RNA were measured using a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (RIN>7.0; Agilent, CA, USA). Poly(A ...
-
bioRxiv - Genomics 2019Quote: Paired-end DNA sequencing libraries of 28 individuals were generated using Aglilent SureSelect Human All ExonV6 kit (Agilent Technologies, CA, USA) by Novogene Co. ...
-
bioRxiv - Cell Biology 2019Quote: ... the total RNA from each sample was amplified and labeled by using a Low Input Quick Amp WT Labeling kit (Agilent Technologies). Labeled cRNA was purified using an RNeasy Mini kit (Qiagen GmbH) ...
-
bioRxiv - Developmental Biology 2020Quote: ... p10UAST-Robo1-MYC and the p5UAST-HA-Robo1 constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Robo coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The error-prone library of the initial hit of the ACE2 helix scaffolded design was constructed by error-prone PCR with a GeneMorph II Random Mutagenesis Kit (Agilent Technologies) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human M280L mutation in FOXR1 was generated by introducing a point mutation at residue 280 (methionine to leucine) using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) in the pSport6 human FOXR1 plasmid with the following forward 5’-CCAACAGTGCTTGAGCCAGCCAG-3’ and reverse 5’-ATACTTTCTAGCCGAGTGGAAG-3’ primers and verified by nucleotide sequencing ...
-
bioRxiv - Physiology 2019Quote: ... The total RNA quantity and purity were determined by a Bioanalyzer 2100 and RNA 1000 Nano LabChip Kit (Agilent, CA, USA) and samples with an RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2020Quote: ... The VDAC1 mutations at serine 215 to glutamate (S215E) was generated by PCR with QuikChange site-directed mutagenesis kit (Agilent Technology) using pET-VDAC1 as cDNA templates and the following primers ...
-
bioRxiv - Genetics 2020Quote: ... serial sections were stained singly with antibodies against BCL6 and CD8 and a DAB DAB visualization kit (Envision Double Stain system, Dako; USA) for bright field microscopy ...
-
bioRxiv - Systems Biology 2020Quote: ... Immunohistochemical staining was obtained performed using a biotinylated-streptovidin-peroxidase complex (Dako Universal LSAB™+ Kit/HRP-K0690, Dako, Glostrup, Denmark) with DAB (3,3-Diaminobenzidin)-chromogen (Dako-K3468 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Site-specific mutation of K674R was introduced in pQCXIP-FLAG-MD by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The quality of the remaining RNA was checked using a Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) (all RIN values > 9 ...
-
bioRxiv - Zoology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: To identify the causative mutation in these families we sequenced the whole exome of the affected individuals with the SureSelect human AllExon 50Mb kit (Agilent Technologies) and sequenced on the HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: G4-LMCA1: Four glycines between residue K44 and D45 in LMCA1-pET-22b were introduced using the QuickChange mutagenesis kit (Agilent Technologies) and verified by Sanger sequencing (Eurofins ...
-
bioRxiv - Systems Biology 2020Quote: ... Final SMRTbell libraries were quantified using Qubit and qualitative and quantitative analyses were performed using BioAnalyzer DNA 12000 kit (Agilent Technologies), and Fragment Analyzer Large-Fragment kit (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: The K1370R point mutation was introduced into the binary construct pTOC159-GFP-TOC159GM using a site directed mutagenesis kit (Agilent-QuikChangeII) with the primers TOC159S3F and TOC159S3R and resulted in pTOC159-GFP-TOC159GM-K/R ...
-
bioRxiv - Plant Biology 2020Quote: ... The point mutation was introduced in the binary construct 35S-GFP-TOC159GM by using a site-directed mutagenesis kit (Agilent-QuikChangeII) with the primers TOC159S3F and TOC159S3R ...
-
bioRxiv - Biochemistry 2021Quote: The removal of the C327-T331 segment from the CM domain of PniDAH7PS was performed using a QuikChange® II Site-Directed Mutagenesis Kit (Stratagene). The pET28a-PniDAH7PS plasmid was used as the template ...
-
bioRxiv - Genomics 2021Quote: ... Quality check and quantification of total RNA were performed using the Agilent Bioanalyzer 2100 in combination with the RNA 6000 Nano Kit (Agilent Technologies). Libraries were constructed from 1 µg of total RNA using Illumina’s TruSeq stranded mRNA Library Preparation Kit or from 500 ng total RNA using NEBNext Ultra II RNA -polyA+ (mRNA ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative and qualitative assessment of the library was performed using an Agilent dsDNA HS kit on an Agilent 2100 Bioanalyzer (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: ... Fab expression vectors were made by introducing two stop codons following residue D234 (Kabat numbering 57) in the IgG heavy chain vectors using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). Sequences were verified by Sanger sequencing (Genewiz).
-
bioRxiv - Molecular Biology 2020Quote: ... p.C131S active site dominant negative (DN) missense mutation was introduced into pCMV-UBE2E1-FLAG-cmyc using the QuickChange mutagenesis kit (Stratagene Inc.) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... pBT270 was created by introducing the constitutive A1/04/03 promoter (35) and removing the trc promoter from pBT223 using the QuikChange Lightning Kit (Agilent Technologies) and the oligonucleotides OBT314 and OBT315 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We generated E-box point mutations (CANNTG ➔ CANNTA) with the QuikChange II site-directed mutagenesis kit (Agilent, 200523, Santa Clara, CA) per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... All additional site-directed variants of GtCPES and PmCpeB were generated from pGtCPES or pCOLACpeB using the QuikChange® site-directed mutagenesis kit (Stratagene) with help of primers listed in Table 4 (only the forward primer is shown ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site-directed PCR mutagenesis was then carried out to mutate the codon corresponding to valine 189 (GTC into GAC) using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Overlapping PCR was used to add a C-terminus 3Flag epitope and a marker conferring resistance to Nourseothricin and the resulting PCR fragment was transformed into fission yeast using routine protocols ...
-
bioRxiv - Microbiology 2019Quote: ... encoding the I78A variant of alt-SDHC was obtained by site-directed mutagenesis using QuikChange® II Site Directed Mutagenesis kit (Stratagene) following provider’s instructions and oligos listed in S3 dataset ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was subjected to quality control using 1 µl of amplified cDNA on an Agilent 2100 BioAnalyser and Agilent High Sensitivity DNA kits (Agilent Technologies). 5 µl of cDNA per cell was cleaned using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... RT qPCR analysis was run for the samples using a miScript SYBR Green PCR Kit (Cat. No. 218073) on a Stratagene Mx3005P (Agilent Technologies). Housekeeping gene GAPDH primers were purchased from Qiagen (Cat ...
-
bioRxiv - Genetics 2021Quote: RNA-sequencing libraries were prepared using the SureSelect Strand-Specific RNA Library Prep for Illumina Multiplexed Sequencing kit (Agilent, Cat#: G9691A) according to the manufacturer’s protocol using 100 ng total RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... The mutant eGFP-CCR5-L196K (substitution of L196 with a lysine) was generated by site-directed mutagenesis using the QuickChange II Mutageneis kit (Agilent Technologies) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... Human α7-nAChR R208I-GFP and E211N-GFP were generated from pcDNA3.1-CHRNA7-mGFP and human α3-nAChR I284R-GFP and N287E-GFP were generated from human α3-nAChR-GFP by PCR based QuikChange® Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Disruption of the Lmxb1 binding sites was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) following manufacturer recommendations and confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... HA-USP29 siRNA-resistant and the catalytically inactive USP29C294S were generated using the QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene) and the oligos reported in Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid substitutions were introduced using a QuikChange II XL site directed mutagenesis kit (200521) purchased from Agilent (Santa Clara, CA). After transformation into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2021Quote: ... The quality of obtained libraries were analyzed using Agilent Bioanalyzer 2100 and High Sensitivity DNA kit (Agilent, cat. no. 5067-4626). Finally ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing was performed on genomic DNA from Patients 1 and 2 and their parents using a SureSelect Human All Exon kit (Agilent Technologies) for targeted enrichment ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... Total RNA from all other cell lines was used to prepare cDNA sequencing libraries using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies) after the polyA selection step ...
-
bioRxiv - Cell Biology 2019Quote: ... and integrated lentiviral sgRNA sequences were amplified by a two-step PCR reaction (20 cycles and 14 cycles, respectively) as previously described (32, 41) using a Herculase II Fusion DNA Polymerase kit (Agilent biotechnologies). DNA was purified after each of the PCR reactions using a QIAquick PCR purification kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The concentration and quality of the purified libraries were determined using the Agilent High Sensitivity DNA kit (Agilent Technologies, 5067-4626) on the Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Pathology 2021Quote: ... and the RNA integrity number (RIN) was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies). The kit used for library construction was the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...