Labshake search
Citations for Agilent :
4551 - 4600 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... and the quality of RNA based on the RNA Integrity Number was estimated using either the 2100 BioAnalyzer (Cat no: G2939BA; RNA 6000 Nano Kit; Cat no: 5067-1511. Agilent), 5200 Fragment Analyzer (Cat no ...
-
bioRxiv - Developmental Biology 2024Quote: ... Different phosphorylation state isoforms for phf10 mRNA were generated by site-directed mutagenesis using QuikChange Multi Site-Directed Mutagenesis kit (#200514, Agilent), following manufacturer’s instructions and specific primers (Supp ...
-
bioRxiv - Developmental Biology 2024Quote: Donor plasmid PAM sites were mutated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Genetics 2023Quote: ... ND-1000 UV-visible light spectrophotometer (Nanodrop Technologies) and Bioanalyzer 2100 with the RNA 6000 Nano Lab Chip kit (Agilent) was used to assess the concentration and integrity of RNA.
-
bioRxiv - Microbiology 2024Quote: ... The integrity of the RNAs was verified using the Agilent 2100 bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). RT-pPCR experiments and data analysis were performed as described (19) ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Molecular Biology 2024Quote: The CtIP-S276A variant was prepared by mutating the respective wild-type pFB-2xMBP-CtIP-10xhis plasmid by QuickChange site-directed mutagenesis kit following manufacturer’s instructions (Agilent Technology). The wild-type protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then single indexed libraries were prepared using Agilent Sure-Select methodology (XT-HS kit, Agilent, Santa Clara, CA, US). The libraries (some pooled ...
-
bioRxiv - Immunology 2024Quote: ... The libraries were analyzed for size distribution and concentration using BioAnalyzer High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA). Libraries were pooled at equimolar concentrations and sequenced on Novaseq6000 (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... Each library was barcoded and analyzed with the High Sensitivity DNA Analysis Kit for the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Libraries were sequenced as single-end 50-bp reads on an Illumina HiSeq 4000 platform by the DNA Technologies Core at the UC Davis Genome Center.
-
bioRxiv - Plant Biology 2019Quote: ... The mutant versions of soybean SymRKα and Gα genes were generated by using the Quick-change® Site-Directed Mutagenesis Kit (Agilent). For overexpression ...
-
bioRxiv - Biophysics 2021Quote: ... DNA concentrations were determined with a Qubit dsDNA BR kit and the quality confirmed using gel electroporation on a 2200 TapeStation with D1000 Screentapes (Agilent Genomics).
-
bioRxiv - Microbiology 2021Quote: ... Sso topo III gene was mutated to the Sso topo III Y318F by replacing residue Tyr318 with Phe using the QuickChange™ Site-Directed Mutagenesis Kit (Stratagene) according to the instructions of manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... A negative control construct in which the start codon was mutated to an ATT was generated using a Quikchange II Site-directed mutagenesis kit (Agilent 200521). The wild-type and mutant plasmids were verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... R242 was mutated to an alanine to prevent allosteric inhibition of WspR using the QuickChange Lightning Site Directed Mutagenesis kit (Agilent technologies), as described previously ...
-
bioRxiv - Microbiology 2020Quote: ... a non-conserved cysteine (C232) was mutated to a serine with the aid of the QuickChange Lightning Site Directed Mutagenesis kit (Agilent technologies) and confirmed with DNA sequencing (ACGT DNA Technologies Corporation) ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2019Quote: The PCR product was inserted in pEGFP-N1 vector using Gibson cloning (Gibson et al., 2009) and mutagenized using the Quickchange II site directed mutagenesis kit (Agilent #200523) and the following primer set:
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine-3 (Cy3) labeled cRNA was prepared from 200 ng of total RNA using the One-Color Quick Amp Labeling kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were then gel extracted and cloned into a vector using the Strataclone PCR Cloning kit (Agilent, Santa Clara, CA) and Sanger sequenced using the BigDye Terminator Cycle sequencing kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: We assessed the respiratory capacity of NPKO and control cells using the Cell Mito Stress Test Kit (Agilent Cat. #103010-100) on the Agilent Seahorse XFp instrument ...
-
bioRxiv - Immunology 2021Quote: The KA and LALA mutations were introduced to the Fc fragment of 2219 by QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) according to the instruction manual ...
-
bioRxiv - Microbiology 2021Quote: ... Mutagenesis was performed as previously described (Hibbing & Fuqua, 2011, Mohari et al., 2018) using the protocol described in the QuickChange Site-Directed Mutagenesis Kit (Stratagene Corp) or the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... The frozen tissues were ground and total RNA was extracted by using the Agilent Plant RNA Isolation Mini Kit (Agilent Technologies). Three biological replicates were prepared for each time point ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The library quantification and quality verification were done using the Fragment Analyzer (AATI) in combination with HS NGS Kit (Agilent Technologies). Sequencing was carried out in NextSeq500 Sequencer (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... RNA pools were assessed for quality using the Agilent RNA 6000 Nano kit and Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). Library construction and sequencing was performed at the Australian Genomic Research Facility ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Point mutations were inserted by using the Quick-change II kit for site directed mutagenesis (Agilent Biosciences, Santa Clara, CA, USA), TOPO-blaOXA-48 as a template and the respective primers (Table S3) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed an RNA Integrity Number Analysis (RIN Analysis) measuring the RNA concentration with the Agilent RNA 6000 Nano Kit using an Agilent 2100 Bioanalyzer (Agilent Technologies) for quality control ...
-
bioRxiv - Microbiology 2021Quote: Integrity of RNA purified from indicated BMDM or PM samples was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies). All samples showed RNA integrity number > 8 ...
-
bioRxiv - Evolutionary Biology 2021Quote: The association between the lymphomas and EBV was examined on a previously formalin-fixed and paraffin-embedded tissue sections of the same tumor biopsy using the PNA in situ hybridization (ISH) kit (Dako, K5201) together with a PNA-probe to detect Epstein-Barr encoded RNAs (EBERs ...
-
Distal regulation, silencers and a shared combinatorial syntax are hallmarks of animal embryogenesisbioRxiv - Developmental Biology 2021Quote: The ATAC-seq library pool was quantified on the Agilent Bioanalyzer with the High Sensitivity DNA kit (Agilent Technologies, 4067-4626). The pool is assessed by qPCR using the KAPA Library Quantification Kit - Illumina/Universal (KAPA Biosystems ...
-
bioRxiv - Microbiology 2020Quote: Mutations were introduced into a previously described TgMLC1 allelic replacement plasmid (55) using the Quick Change site-directed mutagenesis kit (Agilent Technologies). E.coli were transformed with the mutagenized plasmids and colonies screened by colony PCR and restriction digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... The FLAG-tagged version of Cp was created by sequential mutagenesis reactions using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Physiology 2022Quote: ... RNA quality and quantity were assessed with the 2100 Bioanalyzer system using RNA 6000 Pico or nano kit (Agilent Technologies, France) according to the manufacturer’s instructions (Supplementary Figure S1).
-
bioRxiv - Microbiology 2022Quote: ... fragment length distribution and library quality was first assessed on a Fragment Analyzer using the High Sensitivity DNA Kit (Agilent Technologies). All libraries were then pooled in equimolar ratio and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were quantified with the dsDNA HS Assay kit (Qubit, Cat# Q32851) and profile analysis was performed using the TapeStation (Agilent, TS4200) D500 Screen Tape System (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... All site-directed mutagenesis reactions were performed by following the instructions in the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene, CA). Primers used for PCR and site-directed mutagenesis reactions are indicated in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2021Quote: The GFP tagged FUS P525L variant was created by site directed mutagenesis on the GFP tagged FUS WT construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent; 200521). The primers used to generate the construct were ...
-
bioRxiv - Molecular Biology 2020Quote: ... The c.356T>C or c.407A>T mutation was introduced both into p3FLAG-CARD14wt and pTRE3G-Pur-3FLAG-CARD14wt using QuikChange Lightning Site-Directed Mutagenesis Kits (Agilent Technologies) (p3FLAG-CARD14-M119T /-Q136L or pTRE3G-Pur-3FLAG-CARD14-M119T /-Q136L ...
-
bioRxiv - Molecular Biology 2021Quote: The integrity of isolated RNA was verified using the Agilent 2100 Bioanalyzer with RNA 6000 Pico Kit (Agilent, cat# 5067-1513). RNA-Seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleavage products were separated on the Fragment Analyzer™ using the CRISPR Mutation Discovery Kit (Agilent Technologies, Santa Clara, CA, USA). Editing and HDR frequencies were calculated using the following formula ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality of RNA preps was determined using the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies, Santa Clara, CA) and all samples used in this study had RNA integrity numbers > 7 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were purified with the QIAquick PCR Purification Kit and the final purified library was validated on a TapeStation (Agilent, G2991AA) and sequenced in 300 bp pair-end reads on an Illumina MiSeq sequencer at the Genomic Facility at the University of Guelph (Guelph ...
-
bioRxiv - Molecular Biology 2021Quote: ... To introduce the g.26652G>A mutation we used the Quick-change II XL Site-directed Mutagenesis Kit (Agilent Technologies, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The size and integrity of each in vitro transcript was assessed using the RNA 6000 Nano Kit on the 2100 Bioanalyzer (Agilent Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... Yield and integrity of the isolated RNA was assessed using the RNA 6000 Nano Kit on the 2100 Bioanalyzer (Agilent Technologies). Three independent biological replicates were prepared in this way ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid pKlGal80KR56A coding for KlGal80p with the exchange K5A/R6A was constructed by site directed mutagenesis with the QuikChange multi site-directed mutagenesis kit (Agilent Technologies) with the primers KlGal80NLS1CO and Amp_DS and the plasmid pKlGal80 (Zenke et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were bisulfite converted with the EZ-96 DNA Methylation-Direct MagPrep kit and cleaned up using an automated liquid handling platform (Agilent Bravo). The bisulfite converted libraries were amplified for 12 cycles with KAPA HiFi HotStart Uracil+ ReadyMix (Roche) ...