Labshake search
Citations for Agilent :
351 - 400 of 1499 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Microbiology 2022Quote: ... Crude peptide was subsequently purified by reverse phase high-pressure liquid chromatography on a C18 semiprep column over an acetonitrile gradient with 0.1% trifluoroacetic acid and analyzed by liquid chromatography triple quadrupole mass spectrometry (Agilent).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... then reconstituted in 1 mL of 0.1 % trifluoroacetic acid and desalted using an Agilent Macroporous Reversed-Phase C18 column (4.6 × 50 mm mRP-C18, Agilent) on a 1260 Infinity HPLC system (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... Periodic acid-Schiff (PAS) and hematoxylin and eosin (H&E) staining were performed using standard procedures (Dako, Glostrup, Denmark) for the assessment of normal structures.
-
bioRxiv - Microbiology 2024Quote: ... Cell free supernatants were acidified with formic acid (0.1% final concentration) and analysed by GC-FID using a DB-FFAP column (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Separation of amino acid was done with a Zorbax Eclipse XDB-C18 column (50 × 4.6 mm, 1.8 μm, Agilent Technologies). The mobile phase comprised of solvent A (water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Amino acid deletions for ΔKPQ were generated by use of the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent, USA). PCR products were cloned into XL-10 Gold Ultracompetent cells ...
-
bioRxiv - Plant Biology 2024Quote: ... The digest was acidified to pH 3 with trifluoroacetic acid (TFA) and desalted using SampliQ C18 SPE cartridges (Agilent), according to the manufacturer’s guidelines ...
-
bioRxiv - Physiology 2024Quote: ... Peptides were reconstituted in 50 µL 15% ACN/0.1% acetic acid and analyzed on an 1290 Infinity II LC system (Agilent) coupled to QTRAP instrument (Sciex ...
-
bioRxiv - Cell Biology 2024Quote: ... All point mutations and amino acid deletions were incorporated into constructs using the QuikChange site-directed mutagenesis kit (Agilent). All constructs were expressed using either the pINDUCER20-C1-EGFP lentiviral vector (Crawley et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Developmental Biology 2024Quote: ... Exomic sequences from DNA samples were enriched using SureSelect Human All Exon V.6 Kit (Agilent Technologies #5190-8892) according to the manufacturerer protocol followed by sequencing on a Hiseq PE150 (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...