Labshake search
Citations for Agilent :
201 - 250 of 1499 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: Substitutions of S amino acids were introduced using Quikchange Lightning Site-Directed Mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... AMP-derivatised fatty acids as [M+H]+ were aligned using Mass Profinder v10.0 (Agilent Technologies) with an RT tolerance of 0.5 min and MS1 tolerance of 10 ppm ...
-
bioRxiv - Biochemistry 2024Quote: ... Pulsed-splitless injection was used to apply 5 μL samples to a HP-5 ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies; 30 m X 250 μm X 0.25 μm) at an inlet temperature of 220°C and a transfer temperature of 240°C ...
-
bioRxiv - Cell Biology 2020Quote: ... at 5 ng/μl and pBSKS (Stratagene) at 70 ng/μl for a total of 100 ng/μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 minutes with Liquid DAB (Dako). Samples were counterstained with hematoxilin.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Systems Biology 2024Quote: ... Fe(III)-NTA cartridges (Agilent, 5 µL) were initially primed with 100 µL of 50% MeCN/0.1%TFA and equilibrated with 50 µL of 80% MeCN/0.1% TFA ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM HEPES (Agilent, Cat. # 103337-100 ). Cells were plated in Seahorse 96 well plates (Agilent ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Biochemistry 2024Quote: ... pre-incubated for at least 30 min at 6 °C within the Vialsampler (G7129A, Agilent), and then loaded on a Superdex 200 Increase 10/300 column (Cytiva ...
-
bioRxiv - Cancer Biology 2024Quote: ... were separated by injecting 5 μL sample on a ZORBAX SB-C18 column (2.1*50 mm, 5 µm, Agilent). The mobile phase was as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Cancer Biology 2024Quote: ... 30 mM ammonium acetate (NH4Ac) (aq) + 0.1% formic acid (FA) + 0.0015% InfinityLab Deactivator (Agilent Technologies, Inc.) in 1% MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... Filtered samples (0.22 nitrocellulose filter) were analyzed for glucose and acetate acid using HPLC (Agilent 1260) with a refractive index detector and with a reverse-phase column C18 (Waters ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Microbiology 2024Quote: ... Single amino acid mutants were created using the QuikChange II XL site directed mutagenesis kit (Agilent). Primers were designed to introduce mutations at Met68 ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...