Labshake search
Citations for Agilent :
251 - 300 of 1499 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Plant Biology 2024Quote: ... A splitless injection volume of 1 μL was injected onto an HP-5 column with 5% phenyl methylpolysiloxane stationary phase (Agilent) with dimensions of 30 m x 0.25 mm x 0.25 μm ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Cell Biology 2024Quote: ... Organoid domes were imaged on 6-well plates with a BioTek LionHeart LX microscope (Agilent, USA). Images were captured with 10X objective and stitched with built-in software ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... blocked and permeabilized with 5% goat serum (Dako) and 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm (Agilent Technologies, Santa Clara, CA, USA) under isocratic conditions (0.1 M sodium acetate buffer ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Biochemistry 2024Quote: ... Bond Elut PBA (phenylboronic acid) cartridge and 96-well plate were purchased from Agilent (Santa Clara, USA). 1 µM of q and Q was spiked in human plasma and extracted with SPE cartridges ...
-
bioRxiv - Plant Biology 2024Quote: ... Amino acid contents were measured using a triple quadrupole LC-MS/MS system (Agilent 6420, CA, USA) with a Discovery HS-F5 column (2.1 × 250 mm ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Microbiology 2024Quote: ... and dispensed 30% acetic acid using the BioTek EL406 microplate washer/dispenser (Agilent, Santa Clara, CA, USA). The absorbance of CV-stained biofilms was recorded at 590 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μM of Carbonyl-cyanide-4 (triflouoromethoxy) phenylhydrazone (FCCP) (Agilent) was added ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from near-confluent 6 cm dishes using the Absolutely RNA Miniprep kit (Agilent) including an on-column DNase treatment step according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cultures were blocked for 45 min with blocking buffer (BB) containing 6%Goat serum (Dako, S-100) in DPBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... serotype 6 (AAV6) vector plasmid derived from the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA). Experiments were performed with rAAV6 vectors produced and purified by SignaGen Laboratories (Frederick ...
-
bioRxiv - Immunology 2023Quote: The following primary antibodies were used after performing antigen retrieval with Target Retrieval solution (pH 6) (Dako): rabbit anti-DCLK1 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... then impedance was measured every 15 min for 6 h using an xCELLigence RTCA DP instrument (Agilent). Due to the nature of the assay ...
-
bioRxiv - Microbiology 2021Quote: ... Each lipid spot was extracted for quantification of fatty acids by gas chromatography-mass spectrometry (Agilent 5977A-7890B) after methanolysis ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutagenesis of individual amino acid residues in KRaION1 was done using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Forward and reverse primers used to generate each mutant are provided in Supplementary Table 6 ...