Labshake search
Citations for Agilent :
3451 - 3500 of 6127 citations for Human Malonyl CoA Decarboxylase Mitochondrial MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... and QC by High Sensitivity DNA kit analysed using the 2100 Bioanalyzer High Sensitivity DNA assay (Agilent). Sequencing was performed using the HiSeq4000 Sequencing System (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from the leaf tissue using the Plant RNA Isolation Mini Kit Protocol (Agilent Technologies). RNA quality and concentration was measured using a NanoDropTM Lite Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). All samples were pooled to equimolar concentration and sequenced together across twenty-eight lanes on an Illumina Hi-Seq 4000.
-
bioRxiv - Neuroscience 2021Quote: ... followed by incubation with freshly prepared AB mix of Vector Elite ABC Kits and with DAB (DAKO Agilent Pathology Solutions ...
-
bioRxiv - Neuroscience 2020Quote: ... C289A) were generated by site directed mutagenesis of pRmHA3-CaMKII using QuickChange Lighting Kit (Agilent, Catalog 210518.) The full coding sequence of all pRmHA3-CaMKII constructs was verified by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1 μg total RNA template per reaction was used using High Capacity cDNA Reverse Transcription Kit (Agilent). RNAase-free water (total 4.2 μl) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using AffinityScript cDNA synthesis kit according to manufacturer’s instructions (Agilent Technologies, CA, USA). Commercially available gene-specific TaqMan probes for Ager (Mm 01134790_g1) ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was assessed using the Agilent 2100 Bioanalyzer and RNA Nano Chip kit (Agilent Technologies, CA). RNA-seq libraries were generated using TruSeq Stranded Total RNA with Ribo-Zero Globin Complete kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... libraries were prepared using the Illumina TruSeq stranded mRNA kit and validated on the Bioanalyzer 2100 (Agilent). Samples were sequenced using the Illumina HiSeq 2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Genomics 2022Quote: ... and an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies Ltd., Cork, Ireland), according to the manufacturers’ instructions ...
-
bioRxiv - Pathology 2022Quote: ... The libraries were quantified using the Agilent 2100 Bioanalyzer System with a High Sensitivity DNA Kit (Agilent) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality of the generated libraries was monitored by using the High Sensitivity DNA Analysis Kit (Agilent) and the Bioanalyzer 2100 ...
-
bioRxiv - Genomics 2022Quote: Lung total RNA quality and quantity were examined using a Bioanalyzer (Agilent 2100, RNA 6000 nano kit). Sequencing libraries were constructed using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The quality of RNA isolated was checked using Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA). For RNA seq ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets were lysed and RNA was isolated using the Absolutely RNA Microprep Kit (400805, Agilent Technologies), Absolutely RNA Nanoprep Kit (400753 ...
-
bioRxiv - Immunology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
bioRxiv - Immunology 2022Quote: ... and Bioanalyser-2100 equipped with an RNA 6000 Nano Kit (5067-1511; Agilent Technologies, Santa Clara, CA). cDNA was synthesized using iScript Kit (1708891 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the quality of the RNA samples checked on an Agilent Bioanalyzer (Agilent; RNA 6,000 Nano kit).
-
bioRxiv - Neuroscience 2022Quote: RNA integrity was analyzed on an Agilent 2100 Bioanalyzer using RNA 6000 Nano kit (Agilent, 5067-1511). Only samples with an RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2022Quote: ... constructs were generated by site-directed mutagenesis based on enNTS1ΔM4 (M2044.60/M2084.64/M2445.45/M2505.51/M3306.57/M3527.36) using the Lightning site-directed mutagenesis kit (Agilent, Santa Clara, CA) and the forward and reverse primers CACTACTTCTACCTGCTGTCTAACGCGCTGG and CCAGCGCGTTAGACAGCAGGTAGAAGTAGTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library QC was assessed using an Agilent Technologies Bioanalyzer High Sensitivity kit (Agilent Technologies, Cat#5067-4626).
-
bioRxiv - Molecular Biology 2019Quote: CbAgo double mutant (D541A, D611A) was generated using an adapted Quick Directed Mutagenesis Kit instruction manual (Stratagene). The primers were designed using the web-based program primerX (http://bioinformatics.org/primerx).
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and RNA quality was assessed using an Agilent 2100 Bioanalyzer and an RNA 6000 Nano kit (Agilent) to confirm integrity ...
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).
-
The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infectionbioRxiv - Immunology 2019Quote: The oxygen consumption rate was measured using the XF Cell Mito Stress Test Kit (Seahorse, Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies) and purified as for the wild-type proteins.
-
bioRxiv - Plant Biology 2019Quote: ... site-directed mutagenesis was conducted by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) and pPha21-oe was used as a template ...
-
bioRxiv - Genetics 2019Quote: ... The average size of all libraries was analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) and the libraries concentration was measured by qPCR using SensiMix SYBR (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was analyzed for quality using the Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA) with RNA Integrity Numbers (RINs ...
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Biochemistry 2019Quote: ... Seahorse XF base media without phenol red and Mito Stress Kits were from Agilent (Santa Clare, USA). All other chemicals including palmitate and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mutagenesis of the putative Sp1 binding sites was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). All the reporter constructs were inserted and analyzed at the same landing attP site ...
-
bioRxiv - Cell Biology 2020Quote: ... and rotenone/antimycin A provided with the XF Cell Mito Stress Test Kit (#103015-100, Seahorse Bioscience) were prepared in XF assay medium (100840-000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenesis was carried out with the QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and confirmed by DNA sequencing.
-
bioRxiv - Immunology 2020Quote: ... The RNA quality was controlled using Agilent RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) on an Agilent 2100 Bioanalyzer instrument (Agilent Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Genomics 2021Quote: ... The WES libraries were prepared using the SureSelect capture V5+UTR kit (Agilent, Santa Clara, CA, USA) and sequenced with 100bp paired-end sequencing on a HiSeq 2500/4000 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All site-directed mutagenesis (SDM) reactions were carried out using the QuikChange Lightning SDM Kit (Agilent, USA). The mutations were verified by sequencing (Eurofins Genomics ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNase-treated gDNA was used to construct sequencing libraries using the Agilent SureSelectXT Reagent Kit (Agilent Technologies). Libraries were prepared for capture with 6 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Denaturing gel electrophoresis and finally using DNA/RNA 1000 chip kit in a Bioanalyzer 2100 (Agilent Technologies) and quantified by Quant-iT™ RiboGreen® Assay kit (Life Technologies).
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).