Labshake search
Citations for Agilent :
3301 - 3350 of 6127 citations for Human Malonyl CoA Decarboxylase Mitochondrial MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Cell Biology 2024Quote: ... size distribution was examined on the Fragment Analyzer with High Sensitivity NGS Fragment Analysis kit (Agilent), to ensure that the samples were the proper size ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HCK ORFs were performed using QuickChange Lightening Site-Directed Mutagenesis kit (Agilent Technologies, Les Ulis) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA quality was assessed using the RNA 6000 Pico Assay kit (#5067-1513, Agilent Technologies). Two male medial prefrontal cortex samples (50 μg/kg Mixed BP and 150 μg/kg Mixed BP ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were visualized on an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies) and quantified using Qubit dsDNA HS DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... Mutants of BOSS and dROS1 were generated by site-directed mutagenesis using QuickChange Kit (Agilent Technologies). Proteins were purified from the medium (Ex-Cell405 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA quality was further assessed using a total RNA kit on a 2100 Bioanalyzer (Agilent Technologies) and using the generated RIN number to determine quality ...
-
bioRxiv - Cancer Biology 2023Quote: ... and by using High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment AnalyzerTM (Agilent). Libraries were then purified using Agencourt® AMPure® XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quality was tested using the Bioanalyser Agilent RNA 6000 Pico Kit (Agilent Technologies, Waldbronn, Germany). Sequencing libraries were prepared with the TruSeq RNA Sample Prep Kit v2 and sequenced on the Illumina HiSeq 2000 ...
-
bioRxiv - Genomics 2024Quote: ... and fragment lengths were determined using the Genomic DNA 165 kb Kit (Agilent #FP-1002-0275) on the Femto Pulse System.
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 250ng RNA of each sample was retro-transcribed using Affinity Script cDNA synthesis kit (Agilent Technologies). 5ng of cDNA was used for the qRT-PCR reaction using Brilliant III Ultrafast SYBR Green QPCR master mix (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and DNA quality was verified using a Bioanalyzer 2100 with high-sensitivity DNA kits (Agilent, Japan). Short-inserts of 150-bp paired-end libraries were prepared for each individual using a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta samples was assessed by Agilent Bioanalyzer 2100 (Fig. S1C) with the Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511). Then total RNA (500 ng per sample ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... and the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent), respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... The construct cpSRP54(Q185R) was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) with pETDuet1™-cpSRP54 (Bals et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... TFRC or 4-HNE was detected by using a Dako EnVision FLEX kit (Dako, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed recombinant RlmI mutations using a QuikChange Site-Directed Mutagenesis Kit (#200518, Agilent Technologies, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7,7 ...
-
bioRxiv - Biochemistry 2024Quote: ... Mutations were introduced to the p38 expression construct using the QuikChange site-directed mutagenesis kit (Agilent). pCDFDuet-MKK6-EE was a gift from Kevin Janes (Addgene plasmid # 82718 ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity number (RIN) was determined with Agilent RNA 6000 Nano Kit (Agilent, Cat. # 5067-1511) for quality check and all samples were above 8.5.
-
bioRxiv - Immunology 2024Quote: ... OCRs and ECARs were measured using Seahorse XF Cell Mito Stress Test Kit (103015-100, Agilent) and Seahorse XF Glycolysis Stress Test Kit (103020-100 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the size was determined using the TapeStation 4200 with a High Sensitivity D1000 kit (Agilent). All libraries were mixed into a single tube with equal molarity ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated by following the microprep RNA isolation protocol and kit by Agilent (CAT#: 400805). RNA concentration after elution was calculated using a nanodrop in ng/µL of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA size distribution was determined by RNA 6000 Pico Kit for 2100 Bioanalyzer systems (Agilent).
-
bioRxiv - Molecular Biology 2024Quote: ... The quality of DNA samples was analysed using the high sensitivity DNA kit (Agilent 5067-4626) in Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Cancer Biology 2024Quote: ... Quality of the RNA extraction was assessed using the 2100 Bioanalyzer (Agilent, RNA 6000 Nano Kit) and selecting samples with a RNA Integrity Number (RIN ...
-
bioRxiv - Neuroscience 2024Quote: RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥8.7 ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and analyzed by using a High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies), verified by DNA sequencing and purified as for the wild-type protein.
-
bioRxiv - Cancer Biology 2021Quote: ... purified libraries were validated and quantified using an Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent, Cat#: 50674626) and a Qubit dsDNA High Sensitivity Quantitation Assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Libraries were sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The quality of purified DNA libraries was assessed using the Agilent High Sensitivity DNA kit (Agilent Technologies). Paired end ...
-
bioRxiv - Cell Biology 2020Quote: ... and SV40 large T antigen (LT) were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Point mutations in FAM111A and FAM111B were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...