Labshake search
Citations for Agilent :
3551 - 3600 of 6127 citations for Human Malonyl CoA Decarboxylase Mitochondrial MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The mutant construct for Gpdh was made using QuickChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies #210518). The wildtype construct was used a template for mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Each mutagenesis reaction was performed using QuikChange II Site-directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) and the mixtures were made according to manufactures guidelines ...
-
bioRxiv - Cancer Biology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Biophysics 2022Quote: ... Relative permittivity and electrical conductivity were measured using a dielectric probe kit (85070 E, Agilent Tech. Inc.) for a range of frequency between 950 MHz and 2400 MHz and heat capacitance was measured using a KD2 thermal properties analyzer (Decagon Devices Inc.).
-
bioRxiv - Biophysics 2022Quote: ... Relative permittivity and electrical conductivity were measured using a dielectric probe kit (85070 E, Agilent Tech. Inc.) for a range of frequency between 950 MHz and 2400 MHz and heat capacitance was measured using a KD2 thermal properties analyzer (Decagon Devices Inc.).
-
bioRxiv - Cancer Biology 2022Quote: ... Mitochondrial respiration was studied by monitoring OCR using Seahorse Cell Mito Stress Test kit from Seahorse Bioscience and glycolytic activity was studied by monitoring ECAR using Seahorse Glycolysis Stress Test Kit from Seahorse Bioscience. Cells were plated at a density of 1 × 104 cells per well ...
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...
-
bioRxiv - Cancer Biology 2022Quote: ... The libraries were analyzed for insert size distribution by using a 2100 BioAnalyzer High Sensitivity kit (Agilent). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA concentration and integrity were determined using the Bioanalyzer High Sensitivity RNA Pico Kit (Agilent #5067-1513). Sequencing libraries were prepared using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs #E6420 ...
-
bioRxiv - Cell Biology 2022Quote: ... according to the manual of Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, cat#103015-100). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was then purified and transcribed using the RNA MAXX In Vitro Transcription Kit (Agilent) to produce the sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in two runs of the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Library quality and size distribution was verified using a TapeStation D5000 HS kit (Agilent Technologies, 5067-5592). Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp ...
-
bioRxiv - Genomics 2022Quote: ... The library size was estimated on Agilent Bioanalyzer 2100 using high sensitivity DNA kit (Agilent, United States). The normalized libraries were sequenced for 150 bp paired-end reads on Illumina NextSeq 500 platform using NextSeq 500/550 v2 and v2.5 sequencing reagent kits (Illumina Inc. ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The mRNA-seq libraries were constructed by using SureSelect Strand Specific RNA Library Prep kit (Agilent Tech.) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). For expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... This was achieved by site-directed mutagenesis (QuikChange II Site Directed Mutagenesis Kit (Agilent, Santa Clara, CA)) using the primers EmaA-Pro-X-Gly-F and EmaA-Pro-X-Gly-R (Table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The mVSGG1954 mutant S321A was generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... pooled and checked again using a Bioanalyzer (Agilent High Sensitivity DNA Kit, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Site-directed mutagenesis was performed using a QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library size was verified with a Bioanalyzer using an Agilent High Sensitivity DNA kit (Agilent Technologies). The concentration of each library was determined using the KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sequencing libraries were analyzed on an Agilent 2100 Bioanalyzer (High sensitivity DNA analysis kit, Agilent, 5067-4626) pooled in equimolar amounts (2.8 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... AIRR-seq libraries were then quality controlled using the 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA quality was determined with Agilent’s 2100 Bioanalyzer using the High Sensitivity DNA Kit (5067-4626, Agilent) according to manufacturer’s instructions (representative images in Fig 1b).
-
bioRxiv - Microbiology 2022Quote: ... and an Agilent FEMTO Pulse System with a Genomic DNA 165 kb Kit (Agilent, FP-1002-0275), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...
-
bioRxiv - Synthetic Biology 2022Quote: ... spectrophotometry with a NanoDrop (Thermo) and on a 2100 Bioanalyser using an RNA 2000 Nano Kit (Agilent). RNA sequencing was performed by Novogene Co ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection of bound primary antibody was achieved using Dako EnVision + TM Peroxidase Rabbit Kit (DAKO, Glostrup, Denmark) or Dako EnVision + TM Peroxidase Mouse Kit (DAKO ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutant constructs (mut_GLA_FLAG/pCR3.1) were prepared by site-directed mutagenesis (Site-Directed Mutagenesis Kits, QuickChange II, Agilent) and selected by sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... Mutagenesis of CHRD and P1.40 was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The integrity of the sequences of all constructs was confirmed by Sanger DNA sequencing.
-
bioRxiv - Microbiology 2022Quote: ... RNA integrity was assessed with a 2100 Bioanalyzer and the Prokaryote Total RNA 6000 Pico Kit (Agilent). All samples had an RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2022Quote: ... while oxygen consumption rate (OCR) assessed using a Cell Mito Stress Test kit (Agilent Technologies, 103015-100). ECAR and OCR were determined with an XF24 Extracellular Flux Analyzer (Seahorse Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... Other variants were made by mutagenesis using QuickChange lightning Multi Site-Directed Mutagenesis Kit (cat # 210515, Agilent) or via synthesis and cloning (Genscript ...
-
bioRxiv - Synthetic Biology 2024Quote: The SrIRED gene was amplified with error-prone PCR using the GeneMorph II random mutagenesis kit (Agilent) following the instructions of the manufacturer using 2.4 µg template plasmid and 25 PCR cycles ...
-
bioRxiv - Pathology 2023Quote: ... additional biotinylation of the primary antibody was performed using Dako Animal Research Kit Peroxidase (K3954, Dako, Denmark). Additionally ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA integrity was assessed by RNA 6000 Nano Reagent kit on a Agilent 2100 Bioanalyzer (Agilent Technologies) (Carli et al. ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cloned using StrataClone PCR cloning kit (product no: 240205, Agilent technologies Sweden AB, Kista) and re-amplified with M13F/M13R primers using DreamtTaq (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... The quality of the libraries was checked on the Agilent Bioanalyzer with High Sensitivity DNA kit (Agilent); per sample libraries were sequenced on Illumina Novaseq 6000 with target sequencing depths of 25,000 -70,000 reads per nucleus.
-
bioRxiv - Cell Biology 2024Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Poly(A ...
-
bioRxiv - Neuroscience 2024Quote: ... The quality and quantity of RNA were confirmed using NanoDrop and Bioanalyzer RNA 6,000 nano Kit (Agilent). Samples with RNA integrity number values exceeding 6.5 were used for RNA sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Per reaction 200 ng RNA was amplified and Cy3-labeled using the LIRAK kit (Agilent; #5190-2305) following the kit instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Mpro mutants were generated using the QuikChange® II Site-Directed Mutagenesis Kit from Agilent (Catalog #200524), using pET-SUMO-Mpro (from strain BetaCoV/Wuhan/WIV04/2019 ...
-
bioRxiv - Neuroscience 2024Quote: ... Integrity of RNA samples was assessed using RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) prior to library preparation ...