Labshake search
Citations for Agilent :
301 - 350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Bioengineering 2024Quote: ... and SPE cleanup was performed using GlycoClean S-Cartridges (Prozyme, Hayward, CA). After cleanup ...
-
bioRxiv - Bioengineering 2024Quote: ... The size of purified DNA was profiled with the genomic DNA ScreenTape assay (range: 200∼60000 bp) via the 4200 TapeStation system (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... any unbound GTP was washed out and the bound GTP levels were measured on Biotek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... RNA integrity (RIN) was evaluated using the 4200 TapeStation System (Agilent; Santa Clara, CA); all RIN values were greater than 8 ...
-
bioRxiv - Biochemistry 2024Quote: ... the GEF protein was added and the absorbance was recorded for an additional on Biotek Synergy HT or Biotek Synergy H1 (Agilent, Winooski, VT). DMSO was employed as vehicle control ...
-
bioRxiv - Biochemistry 2024Quote: ... The unhydrolyzed GTP that was converted to ATP was recorded on BioTek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... and RNA integrity numbers (RINs) were determined using a TapeStation (Agilent) (average RIN of 7.5) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Biochemistry 2024Quote: Spectra of dark-adapted AsLOV2 and NcVVD variants were acquired at 22°C on a diode-array absorbance spectrophotometer (Agilent Technologies, model 8453) equipped with Peltier temperature control (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: ... RNA quantity and purity analysis was done using Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Immunology 2024Quote: ... The size distribution of the libraries was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, #5067-4626), and the DNA concentration was quantified using a Qubit dsDNA HS Assay Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... a web-based application (Agilent). PCR-based mutagenesis was performed using KOD plus neo DNA polymerase (TOYOBO).
-
bioRxiv - Biochemistry 2024Quote: ... 300 µL of each reaction mixture were placed in a quartz cuvette and monitored at 550 nm using a Cary60 spectrophotometer (Agilent technologies). After 10 seconds ...
-
bioRxiv - Biochemistry 2024Quote: ... using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) and mutagenic primers listed in Supplementary Table 3.
-
bioRxiv - Biochemistry 2024Quote: ... Analysis of the sample solutions was performed on an Agilent 5975C Mass Spectrometer (Agilent Technologies, CA, USA) using a Zebron ZB-5HT Inferno GC column (30 m x 0.25 mm i.d. ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescence spectra of proteins containing ZnPPIX were measured from 550-750 nm in a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 430 nm ...
-
bioRxiv - Biochemistry 2024Quote: ... Total iron and copper concentrations were assessed by a tandem quadrupole 8800 ICP-QQQ system (Agilent Technologies, Santa Clara, CA, USA) using mixed hydrogen and helium as reaction cell gases ...
-
bioRxiv - Biochemistry 2024Quote: ... Cleavage was validated by SDS-PAGE and size exclusion chromatography on a Agilent 1260 Infinity II system using an Agilent AdvanceBio SEC 300 Å 2.7 μm 4.6x300 mm column (Agilent Technologies, PL1580-5301) using the manufacturer’s recommended conditions ...
-
bioRxiv - Biochemistry 2024Quote: 150-250 µg fragments of LDPE film discs were placed in deactivated stainless-steel sample cups and introduced into a multi-shot EGA/PY-3030D pyrolyzer (Frontier Laboratories, Fukushima Japan) coupled to a 7890N gas chromatograph and a 5975 mass selective detector (Agilent Technologies, Santa Clara, CA, USA). The furnace temperature was set to 550 °C and the temperature of the interface between the furnace and the GC/MS system was set to 200 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... and the molar mass distribution in PVC materials were determined using a 1260 HPLC system equipped with three PLgel 5 µm Mixed-C columns and a PLgel guard column (Agilent Technologies, Santa Clara, CA, USA). Approximately 5 mg of PVC was dissolved in 1 mL of tetrahydrofuran at room temperature for at least 14 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 were collected with a 5500 Series spectrometer equipped with a diamond-ATR (attenuated total reflectance) sampling module (Agilent Technologies, Santa Clara, CA, USA). The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise ...
-
bioRxiv - Biochemistry 2024Quote: ... The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise) by performing 35 consecutive readings per measurement in 4,000-650 cm-1 range using MicroLab PC software (Agilent Technologies) and further processed with Spectragryph (F ...
-
bioRxiv - Biochemistry 2024Quote: ... Polystyrene standards with a narrow molecular mass distribution and Mpeak in the range of 1,140 – 7,500,000 g/mol (Agilent Technologies, Santa Clara, CA, USA) were used for calibration.
-
bioRxiv - Biochemistry 2024Quote: ... were determined using a GPC-IR5 system (Polymer Char, Valencia, Spain) equipped with four PLgel 20 µm MIXED-A columns (Agilent Technologies, Santa Clara, CA, USA). Approximately 4 mg of LDPE film was pre-dissolved in 8 mL of 1,2,4-trichlorobenzene at 160 °C for 3 hours and 200 µL samples were injected into the SEC system ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were injected into analysis by an Agilent 6850 Gas Chromatograph system coupled to a 5975 series MSD (Agilent Technologies, Santa Clara, CA, USA) equipped with a Sapiens-5MS (30 m × 0.25 µm × 0.25 µm ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-SUMO-ZF5.3 was transformed into Escherichia coli BL21DE3 Gold (Agilent) and selected on a kanamycin Luria Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: All tryptophan fluorescence assays were performed using a Cary Eclipse fluorimeter (Agilent). Fluorescence emission spectra were collected using 0.5 µM VC0430 in 50 mM Tris ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Biochemistry 2024Quote: ... CaM-linked agarose beads (Agilent) were equilibrated in the same buffer before adding the FBA preparations and incubating for 5 min at room temp ...
-
bioRxiv - Biochemistry 2024Quote: All point mutations were generated using QuikChange II following the manufacturer’s instructions (Agilent, 200523).
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by protein block (X0909, Dako North America). At room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... Immunostaining of corneas was performed according to standard procedure.52 The corneas were mounted in Dako mounting medium (Dako). We replaced the Alexa Fluor 488 dye-conjugated antibodies used in confocal microscopy with STED-dedicated secondary antibodies (abberior STAR RED ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were then treated with proteinase K (S3020, Dako North America, Carpinteria, CA) followed by protein block (X0909 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) were used for quality check of library.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were incubated for 1 hour at room temperature with serum-free protein block (Dako X0909) to block non-specific binding sites followed by Cleaved-Casp3 primary antibody (Abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... Each sample’s RNA was then analyzed using Agilent’s 2100 Bioanalyzer (Agilent Technologies) with the total RNA 6000 Pico Kit ...
-
bioRxiv - Bioengineering 2024Quote: ... and mRNA purity analyzed using a fragment analyzer (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... and concentration of amplicons were determined using a fragment analyzer (Agilent). To add Illumina indexes to the amplicons ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... and quality control was performed using a Bioanalyzer (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... and analyzed using a fragment analyzer (Agilent). Samples were quantified using a Qubit 4 Fluorometer (Life Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... Data were handled using Agilent MassHunter Qualitative Analysis software (Agilent Technologies, Santa Clara, CA). Lock mass solution in 70 % MeOH in water was infused in the second sprayer using an extra LC pump at a flow of 15 μL min−1 using a 1:100 splitter ...
-
bioRxiv - Bioengineering 2024Quote: ... Poroshell 120 Phenyl Hexyl column (Agilent Technologies, Santa Clara, CA) held at 40°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The thermoamplifier constructs were assembled in chemically competent ABLE-K cells (200172) procured from Agilent Technologies (USA) ...
-
bioRxiv - Bioengineering 2024Quote: Ultra-high-performance liquid chromatography–diode array detection–quadrupole time-of-flight mass spectrometry (UHPLC–DAD–QTOFMS) was performed on an Agilent Infinity 1290 UHPLC system (Agilent Technologies, Santa Clara, CA, USA) equipped with a diode array detector ...
-
bioRxiv - Cancer Biology 2024Quote: ... BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, 230280) are transformed with sequence-validated vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of the library was hybridized to the Agilent SureSelect XT Human All Exon V4 probes (Agilent Technologies 5190-4634). The targeted exon fragments were captured by Streptavidin beads (Fisher 65602) ...
-
bioRxiv - Bioengineering 2024Quote: ... peroxidase blocking solution and serum-free protein blocking solution were purchased from Dako (DNK). The O.C.T ...