Labshake search
Citations for Agilent :
251 - 300 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... CK10 (dilution 1:100; Dako Cat#M7002, Glostrup, Denmark), involucrin (dilution 1:200 ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h and detected using a DAB+ staining kit (Dako). Sections were counterstained with Harris hematoxylin ...
-
bioRxiv - Cell Biology 2024Quote: Mutations in the DFCP1 (K193A and R266Q) and ATGL (D166G) were introduced using the QuikChange mutagenesis kit (Agilent, Santa Clara, CA).
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 min at room temperature prior to recording fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 488 nm and measuring emission at 535 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Bioengineering 2024Quote: ... Resulting DNA samples were resolved for size on TapeStation (Agilent, Santa Clara, California, US) for quantification and 2% agarose gel electrophoresis for visualization.
-
bioRxiv - Bioengineering 2024Quote: ... and the RNA concentration was measured using both Xpose spectrophotometry (Trinean) and Fragment Analyzer (Agilent Technologies) capillary electrophoresis.
-
bioRxiv - Bioengineering 2024Quote: ... RNA quality was assessed by capillary electrophoresis using High Sensitivity RNA reagents with the Fragment Analyzer (Agilent Technologies) and the RNA concentration was measured using both Xpose spectrophotometry (Trinean ...
-
bioRxiv - Biochemistry 2024Quote: ... The presentation of epitopes of the BinJV/WNVKUN when applied to the membrane was confirmed using a goat anti-mouse Ig (Dako) conjugated gold nanoparticle (AuNP ...
-
bioRxiv - Biochemistry 2024Quote: A genetic library was constructed based on the metX and metY genes with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA, USA), adjusted to produce an average of 4 nonsynonymous mutations per gene ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Biochemistry 2024Quote: ... Site-directed mutagenesis for all mutants was generated using the QuickChange® mutagenesis kit (Stratagene). The sequences of all constructs were confirmed by DNA sequencing (Azenta).
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were accumulated onto a ZORBAX RRHD Extended-C18 column (80Å pore size, 2.1 x 150mm, 1.8μm particles, Agilent) at 50°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... RNA integrity was assessed using an RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Biochemistry 2024Quote: ... The final sequences were then synthesized as an oligo pool (Agilent Technologies).
-
bioRxiv - Biochemistry 2024Quote: NGS PCR amplicons from RNA guided cleavage reactions were evaluated using D1000 automated electrophoresis (TapeStation; Agilent). Successful plasmid cleavage and PCR amplification produced bands at the ∼180 bp size and were sent for NGS sequencing as previously described3 ...
-
bioRxiv - Biochemistry 2024Quote: ... The calibrated concentrations of the cleavage product bands (electrogram peak areas) were used to calculate percent cleavage from total plasmid band intensity using TapeStation Analysis software (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Bioengineering 2024Quote: ... and SPE cleanup was performed using GlycoClean S-Cartridges (Prozyme, Hayward, CA). After cleanup ...
-
bioRxiv - Bioengineering 2024Quote: ... The size of purified DNA was profiled with the genomic DNA ScreenTape assay (range: 200∼60000 bp) via the 4200 TapeStation system (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... any unbound GTP was washed out and the bound GTP levels were measured on Biotek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... RNA integrity (RIN) was evaluated using the 4200 TapeStation System (Agilent; Santa Clara, CA); all RIN values were greater than 8 ...
-
bioRxiv - Biochemistry 2024Quote: ... the GEF protein was added and the absorbance was recorded for an additional on Biotek Synergy HT or Biotek Synergy H1 (Agilent, Winooski, VT). DMSO was employed as vehicle control ...
-
bioRxiv - Biochemistry 2024Quote: ... The unhydrolyzed GTP that was converted to ATP was recorded on BioTek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... and RNA integrity numbers (RINs) were determined using a TapeStation (Agilent) (average RIN of 7.5) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Biochemistry 2024Quote: Spectra of dark-adapted AsLOV2 and NcVVD variants were acquired at 22°C on a diode-array absorbance spectrophotometer (Agilent Technologies, model 8453) equipped with Peltier temperature control (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: ... RNA quantity and purity analysis was done using Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Immunology 2024Quote: ... The size distribution of the libraries was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, #5067-4626), and the DNA concentration was quantified using a Qubit dsDNA HS Assay Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 µL of each reaction mixture were placed in a quartz cuvette and monitored at 550 nm using a Cary60 spectrophotometer (Agilent technologies). After 10 seconds ...
-
bioRxiv - Biochemistry 2024Quote: ... using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) and mutagenic primers listed in Supplementary Table 3.
-
bioRxiv - Biochemistry 2024Quote: ... Analysis of the sample solutions was performed on an Agilent 5975C Mass Spectrometer (Agilent Technologies, CA, USA) using a Zebron ZB-5HT Inferno GC column (30 m x 0.25 mm i.d. ...
-
bioRxiv - Biochemistry 2024Quote: ... Total iron and copper concentrations were assessed by a tandem quadrupole 8800 ICP-QQQ system (Agilent Technologies, Santa Clara, CA, USA) using mixed hydrogen and helium as reaction cell gases ...
-
bioRxiv - Biochemistry 2024Quote: ... Cleavage was validated by SDS-PAGE and size exclusion chromatography on a Agilent 1260 Infinity II system using an Agilent AdvanceBio SEC 300 Å 2.7 μm 4.6x300 mm column (Agilent Technologies, PL1580-5301) using the manufacturer’s recommended conditions ...
-
bioRxiv - Biochemistry 2024Quote: 150-250 µg fragments of LDPE film discs were placed in deactivated stainless-steel sample cups and introduced into a multi-shot EGA/PY-3030D pyrolyzer (Frontier Laboratories, Fukushima Japan) coupled to a 7890N gas chromatograph and a 5975 mass selective detector (Agilent Technologies, Santa Clara, CA, USA). The furnace temperature was set to 550 °C and the temperature of the interface between the furnace and the GC/MS system was set to 200 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... and the molar mass distribution in PVC materials were determined using a 1260 HPLC system equipped with three PLgel 5 µm Mixed-C columns and a PLgel guard column (Agilent Technologies, Santa Clara, CA, USA). Approximately 5 mg of PVC was dissolved in 1 mL of tetrahydrofuran at room temperature for at least 14 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 were collected with a 5500 Series spectrometer equipped with a diamond-ATR (attenuated total reflectance) sampling module (Agilent Technologies, Santa Clara, CA, USA). The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise ...
-
bioRxiv - Biochemistry 2024Quote: ... The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise) by performing 35 consecutive readings per measurement in 4,000-650 cm-1 range using MicroLab PC software (Agilent Technologies) and further processed with Spectragryph (F ...
-
bioRxiv - Biochemistry 2024Quote: ... Polystyrene standards with a narrow molecular mass distribution and Mpeak in the range of 1,140 – 7,500,000 g/mol (Agilent Technologies, Santa Clara, CA, USA) were used for calibration.
-
bioRxiv - Biochemistry 2024Quote: ... were determined using a GPC-IR5 system (Polymer Char, Valencia, Spain) equipped with four PLgel 20 µm MIXED-A columns (Agilent Technologies, Santa Clara, CA, USA). Approximately 4 mg of LDPE film was pre-dissolved in 8 mL of 1,2,4-trichlorobenzene at 160 °C for 3 hours and 200 µL samples were injected into the SEC system ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were injected into analysis by an Agilent 6850 Gas Chromatograph system coupled to a 5975 series MSD (Agilent Technologies, Santa Clara, CA, USA) equipped with a Sapiens-5MS (30 m × 0.25 µm × 0.25 µm ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-SUMO-ZF5.3 was transformed into Escherichia coli BL21DE3 Gold (Agilent) and selected on a kanamycin Luria Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: All tryptophan fluorescence assays were performed using a Cary Eclipse fluorimeter (Agilent). Fluorescence emission spectra were collected using 0.5 µM VC0430 in 50 mM Tris ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Biochemistry 2024Quote: ... CaM-linked agarose beads (Agilent) were equilibrated in the same buffer before adding the FBA preparations and incubating for 5 min at room temp ...
-
bioRxiv - Biochemistry 2024Quote: All point mutations were generated using QuikChange II following the manufacturer’s instructions (Agilent, 200523).
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Bioengineering 2024Quote: ... Immunostaining of corneas was performed according to standard procedure.52 The corneas were mounted in Dako mounting medium (Dako). We replaced the Alexa Fluor 488 dye-conjugated antibodies used in confocal microscopy with STED-dedicated secondary antibodies (abberior STAR RED ...