Labshake search
Citations for Agilent :
3201 - 3250 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... RNA content was determined using the Agilent RNA 6000 Pico Kit (Agilent, #5067-1513) with a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... The mutated SV40 enhancer sequences were created with QuickChange site-directed mutagenesis kit (Stratagene) or using InFusion site-directed mutagenesis ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were analyzed using Agilent RNA 6000 Nano Kit and the Bioanalyzer system (Agilent). Thereby ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Neuroscience 2022Quote: ... The concentration of extracted RNA was determined using a NanoRNA kit (Agilent #5067-1511) and Bioanalyzer (Agilent 2100 ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality was evaluated using the Agilent DNA 1000 kit (Agilent, Cat# 5067-1504) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Cell Biology 2024Quote: ... The staining was performed with the Dako LSAB2 System-HRP kit (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library size distributions were confirmed using the High Sensitivity DNA Kit (Agilent #5067-4626) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Systems Biology 2024Quote: ... Both mutations were made using the QuikChange Lightening Site directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions and the sequences were confirmed by DNA sequencing at the Department of Biochemistry (University of Cambridge ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality was checked using RNA 6000 Pico Kit using Agilent 2100 Bioanalyzer (Agilent). Paired-end ...
-
bioRxiv - Neuroscience 2024Quote: ... Southern blot probes were radiolabeled using the Prime-it Random Primer Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis to generate shfP mutants was achieved using the QuikChange kit (Agilent). All plasmids were integrated into the B ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked for quality with Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany). Only RNA samples with RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: ... Library QC was performed using the BioAnalyzer High Sensitivity DNA Kit (Agilent, #5067-4626) and run on the 2100 BioAnalyzer Instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... site directed mutagenesis was used (QuikChange II XL Site Directed Mutagenesis Kit, Agilent, 200521) as directed ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library concentrations were quantified using the Agilent High Sensitivity DNA kit (Agilent Technologies, USA). An equimolar pool consisting of 24 samples was prepared and sequenced on an NextSeq550 (single-read ...
-
bioRxiv - Immunology 2024Quote: ... C188Y and Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 and K183S/K184S/*192C*24 plasmids were produced by ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... Site-directed mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... RNA integrity was confirmed using a Bioanalyzer with the RNA 6000 Nano Kit (Agilent). Two sample replicates (one P1 and one P13 ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quality and quantity were assessed using the Bioanalyzer RNA 6000 Nano Kit (Agilent) following the instructions provided by the manufacturer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA samples concentrations were determined using a Fragment Analyzer High Sensitivity DNA kit (Agilent). Sample concentration was standardized to 10ng/ul.
-
bioRxiv - Plant Biology 2023Quote: Site-directed mutagenesis was performed using Quick Change II Site–Directed Mutagenesis Kit (Agilent) and primers listed in Supplementary Table 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mutation was introduced by site-directed mutagenesis using the QuikChange Lightning Kit (Agilent) per manufacturer’s instructions (mutagenesis primers ...
-
bioRxiv - Neuroscience 2023Quote: QuikChange II Site-Directed Mutagenesis Kit and Dako Fluorescence Mounting Medium were from Agilent Technologies (Santa Clara ...
-
bioRxiv - Systems Biology 2023Quote: ... and RIN values assessed using the Agilent 2200 TapeStation (High sensitivity RNA kit, Agilent).
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were cloned into TOPO vector (Strataclone Blunt PCR Cloning Kit, Agilent 240207) and selected on agar plates with ampicillin and kanamycin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A library quality check was performed using the dsDNA 915 reagent kit (Agilent Technologies) and the Fragment Analyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified on the bio-analyzer using DNA high-sensitivity kit (Agilent, 5067-4626). Barcoded libraries were sequenced on an Illumina NextSeq 500 with 38bp paired-end reads at a depth of about 25 million reads per plates.
-
bioRxiv - Microbiology 2023Quote: ... The library was generated either using QuikChange multisite lightning site directed mutagenesis kit (Agilent) or by PCR amplification followed by Gibson assembly into the original pCDNA-AD8 plasmid and had the diversity of 32 alternative codons ...
-
bioRxiv - Biophysics 2023Quote: ... Point mutations in respective CaV1.3 subsegments were then generated using Quikchange II kit (Agilent). We generate W357A and W718A ...
-
bioRxiv - Biophysics 2023Quote: ... and Q1494K variants were synthesized using QuikChange mutagenesis kit (Agilent Technologies, Santa Clara, CA) with custom made forward (F ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutagenesis was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). 25 ng of dsDNA template vector was mixed with 0.5 µL dNTP mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene). Melanoma cells were transfected with combinations of reporter constructs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The final libraries were profiled using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies) and quantified using the Qubit 2.0 (Thermal Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complementary DNA quality and concentrations were assessed using the High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer and the Qubit 2.0 Fluorometer (Life Technologies).
-
bioRxiv - Immunology 2023Quote: ... cDNA was harvested and quantified with the Bioanalyzer DNA High-Sensitivity kit (Agilent Technologies). Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were cloned using a StrataClone Blunt PCR Cloning Kit (Agilent, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... After verification of library size distribution (∼325bp peak) using Bioanalyzer HS DNA Kit (Agilent), the library pool was subjected to RNA sequencing analysis using the MiSeq Micro V2 (2x150bp ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified using a BioAnalyser high sensitivity DNA kit (Agilent, Cat#5067-4626) and a Qubit high-sensitivity dsDNA kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA quality was assessed using an RNA 6000 Pico kit (Agilent, 5067-1513) on a Bioanalyzer (Agilent G2939A).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quality-accessed with an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) with RNA integrity number above 9 for library construction ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies) in a BioAnalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 at a read length of 38 bp.
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the sections were incubated in HRP rabbit/mouse secondary antibody (DAKO Real EnVision kit) for 30 minutes at room temperature ...