Labshake search
Citations for Agilent :
3001 - 3050 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Physiology 2024Quote: ... OCR was measured using the Cell Mito Stress Test kit (Agilent #103015-100) at 26°C ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using an Absolutely RNA Miniprep kit (Agilent, Santa Clara, CA). RNA quality was measured using RNA 6000 Nano kit on a 2100 Bioanalyzer (Aglient ...
-
bioRxiv - Neuroscience 2024Quote: ... Quality control was performed with the High Sensitivity DNA kit (Agilent, 5067-4626) on a Bioanalyzer ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA integrity was assessed using Agilent RNA 6000 Nano Kit (Agilent, 5067-1511) and RNA concentration was determined using Qubit RNA High Sensitivity Assay Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... secondary antibody was applied from the DAKO REAL EnVision Kit (K500711-2, DAKO) for 1 hour at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... secondary antibody was applied from the DAKO REAL EnVision Kit (K500711-2, DAKO) for 1 hour at RT ...
-
bioRxiv - Pathology 2024Quote: ... DNA was fragmented and tagged for target enrichment using SureSelectQXT reagent kit (Agilent Technologies to generate adapter-tagged libraries ...
-
bioRxiv - Plant Biology 2024Quote: ... and the Fragment Analyzer System with the DNF-471 RNA kit (15nt) (Agilent), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... or an Agilent 4200 TapeStation system with the High Sensitivity RNA kit (Agilent) to analyze purified RNA samples from a range of QC samples collected during sequential steps of the pulldown ...
-
bioRxiv - Molecular Biology 2024Quote: ... amplified and size distribution was checked using High Sensitivity DNA Bioanalyser Kit (Agilent). Library Preparation was performed using Stereo-seq Library Preparation Kit (MGI ...
-
bioRxiv - Molecular Biology 2024Quote: ... The mutations were introduced using QuickChange II XL Site Directed Mutagenesis Kit (Agilent) and Q5 High-Fidelity PCR Kit (New England BioLabs).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA was converted to cDNA using AffinityScript Multiple Temperature Reverse Transcriptase kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and a Femto-Pulse Genomic DNA 165 kb Kit (Agilent, FP-1002-0275). We sequenced each of the libraries on one SMRT cell on the Revio platform (Pacific Biosciences ...
-
bioRxiv - Genomics 2024Quote: ... with the HS-NGS High Sensitivity 474 kit (Agilent, ref DNF-474-0500). Libraries were quantified using qPCR with the NEBNext® Library Quant Kit for Illumina (NEB ...
-
bioRxiv - Genetics 2024Quote: ... concentration and fragment size from the Bioanalyzer HS DNA kit (Agilent, 5067-4626) and sequenced on the Illumina NovaSeq6000 platform (150×150bp PE) ...
-
bioRxiv - Immunology 2024Quote: ... RNA was quantified with the Bioanalyzer RNA 6000 Pico Kit (Agilent, 5067-1513). cDNA libraries were constructed using the SMARTer Stranded Total RNA - Pico Input Mammalian Kit (TaKaRa ...
-
bioRxiv - Genomics 2024Quote: ... and library size was determined using a Tapestation High Sensitivity DNA kit (Agilent). Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies, California, USA). To introduce the first mutation ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA quality was assessed using high sensitivity DNA D1000 tape station kits (Agilent). Sequencing libraries were generated using the ThruPLEX DNA-Seq Kit (Takara ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quality was assessed using high sensitivity DNA D1000 tape station kits (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... Size distribution was assessed by Bioanalyzer High Sensitivity DNA Kit (Agilent, 5067-4626). Finally ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mts point mutations were generated using the Quikchange Site-Directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Random mutagenesis was performed using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Point mutations were generated using the Quikchange Multi Site-Directed Mutagenesis Kit (Agilent). All expression plasmids were sequence-verified.
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was generated using AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene). The Mus musculus IGHV1-72*01 allele (IMGT accession number J00530:206-499) ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA isolation and reverse transcription were performed using the Absolutely RNA Miniprep kit (Stratagene) and cDNA synthesis system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibody was pretreated with a biotinylation reagent (Animal Research Kit, DAKO, Denmark) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... avidin-biotin blockade was performed using the avidin-biotin blocking kit (DAKO, Glostrup, Denmark). To eliminate nonspecific protein interactions with the primary antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was amplified and labeled using the low RNA input linear amplification kit (Agilent). Labeled cDNA was hybridized onto Affymetrix Human Gene 2.0-ST array ...
-
bioRxiv - Developmental Biology 2020Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). RNA-seq libraries were constructed using Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... all DNA libraries were checked with Agilent BioAnalyzer High Sensitivity DNA Analysis Kit (Agilent). DNA concentration was measured both by Qubit dsDNA HS assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Molecular mutants were prepared using the QuikChange II XL site-directed mutagenesis kit (Stratagene). The mCherry plasmid was previously described(Pauker ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutagenesis of the Serine345 codon of Kcnk5b was performed using QuikChange Mutagenesis kit (Agilent).
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Quality was determined on a 2100 Bioanalyzer using the RNA 6000 Nano Kit (Agilent). Concentration was determined using a Nanodrop 8000 spectrophotometer (Thermo Scientific) ...