Labshake search
Citations for Agilent :
3151 - 3200 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... This was corrected by site-directed mutagenesis (SDM) using the QuikChange Lightening kit (Agilent), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Cell Biology 2020Quote: ... and fragmented cDNA integrity was confirmed using the Agilent RNA 6000 Nano Kit (Agilent) and 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... We used the Fragment Analyzer dsDNA 920 Reagent Kit (Agilent Technologies, Santa Clara, CA) to perform the automated gel electrophoresis analysis ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced into bovine rhodopsin using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Point (Site) mutations of SOD2 were generated by QuikChange Site-Directed Mutagenesis kit (Stratagene). Both WT SOD2 and SOD2 mutant plasmids were transfected into ZF4 cells using Lipofectamine 3000 Transfection Reagent (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... or 229 (A229C) using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The mutated constructs were purified as described above ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PEAK3 A436E mutant was generated with the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The pCDNA3.1-V5-PTK2B (PYK2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were tested using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Samples with an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Microbiology 2021Quote: ... Agilent Bioanalyzer with Agilent RNA 6000 Nano Kit (Agilent Technologies, Palo Alto, CA, USA) was used as per manufacturer’s guidelines to assess the integrity of RNA samples ...
-
bioRxiv - Immunology 2020Quote: ... and RNA integrity was evaluated with the Bioanalyzer RNA pico kit TapeStation (Agilent Technologies). Two hundred nanograms of total RNA was subsequently processed to generate RNA-seq libraries using NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA labeling was performed with the two color ‘Quick Amp Labeling Kit’ (Agilent genomics) using a 1:5 mixture of ‘FullSpectrum MultiStart Primer’ (Systembio) ...
-
bioRxiv - Immunology 2020Quote: ... We used the Seahorse XF Cell Mito Stress Test Kit (103015-100, Seahorse Bioscience) for the OCR assay ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was evaluated with an Agilent 2100 Bioanalyzer RNA pico kit (Agilent Technologies) prior to sequencing library preparation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and quantity and quality were verified using RNA 6000 Nano Kit (Agilent – 5067-1511) and an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genomics 2021Quote: ... Library quality and size were assessed using a Bioanalyzer High Sensitivity DNA kit (Agilent). Libraries were run on HiSeq 4000 and NovaSeq6000 in 150 bp × 2 paired-end mode (Illumina ® ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA library was constructed using the SureSelect Low Input library prep kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified using a BioAnalyser high sensitivity DNA kit (Agilent, Cat#5067-4626) and a Qubit high-sensitivity dsDNA kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA quality was assessed using an RNA 6000 Pico kit (Agilent, 5067-1513) on a Bioanalyzer (Agilent G2939A).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quality-accessed with an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) with RNA integrity number above 9 for library construction ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies) in a BioAnalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 at a read length of 38 bp.
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the sections were incubated in HRP rabbit/mouse secondary antibody (DAKO Real EnVision kit) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was performed to create the FLOT2 G2A and FLOT2 Y163F mutants ...
-
bioRxiv - Bioengineering 2022Quote: ... and site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent). The introduction of mutations was confirmed through sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations of LcTwinkle were generated using methods described in the QuikChange mutagenesis kit (Agilent). Sequences of the LcTwinkle constructs were confirmed by sequencing the entire reading frames of each construct ...
-
bioRxiv - Cancer Biology 2022Quote: ... and antigens were visualized with a DAKO Envision Kit (HRP/DAB System; Dako Cytomation).
-
bioRxiv - Cell Biology 2022Quote: ... HA-tagged DCX mutant T203R were created using QuikChange Site-Directed Mutagenesis kit (Stratagene). HA-tagged DCX mutant A71S was synthesized commercially (Genewiz ...
-
bioRxiv - Cell Biology 2022Quote: ... Amplified cDNA was cloned into pSC plasmid (StrataClone Blunt PCR Cloning Kit, STRATAGENE, 240207). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... and programmed cell death ligand 1 (PD-L1; clone 22C3, pharmDx kit, Agilent, USA) were used ...
-
bioRxiv - Genetics 2022Quote: ... The SphI site was mutated to XhoI using a site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... and evaluated using an Agilent 2100 Bioanalyzer (5067-1513, Agilent RNA 6000 Pico Kit). After DNase I (M0303S ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... kit and also checked in the Agilent 2100 Bioanalyzer High Sensitivity DNA (Agilent Technologies). The libraries were run in the in-house Illumina NextSeq 500 using the 300-cycle mid-or high-output kit.
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from mouse lungs using the Absolutely Total RNA Purification Kit (Agilent). RNA extraction from cell culture experiments were performed using the Qiagen RNeasy kit (Qiagen) ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... Site-directed mutations were created using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The FANCD2 ΔTower construct was generated using a QuikChange Site-Directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and fragment size was controlled using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Neuroscience 2022Quote: ... The concentration of extracted RNA was determined using a NanoRNA kit (Agilent #5067-1511) and Bioanalyzer (Agilent 2100 ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...