Labshake search
Citations for Agilent :
3151 - 3200 of 8383 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from mouse lungs using the Absolutely Total RNA Purification Kit (Agilent). RNA extraction from cell culture experiments were performed using the Qiagen RNeasy kit (Qiagen) ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... Site-directed mutations were created using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The FANCD2 ΔTower construct was generated using a QuikChange Site-Directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and fragment size was controlled using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Neuroscience 2022Quote: ... The concentration of extracted RNA was determined using a NanoRNA kit (Agilent #5067-1511) and Bioanalyzer (Agilent 2100 ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Southern blot probes were radiolabeled using the Prime-it Random Primer Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Both mutations were made using the QuikChange Lightening Site directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions and the sequences were confirmed by DNA sequencing at the Department of Biochemistry (University of Cambridge ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality was checked using RNA 6000 Pico Kit using Agilent 2100 Bioanalyzer (Agilent). Paired-end ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were cloned into TOPO vector (Strataclone Blunt PCR Cloning Kit, Agilent 240207) and selected on agar plates with ampicillin and kanamycin ...
-
bioRxiv - Systems Biology 2023Quote: ... and RIN values assessed using the Agilent 2200 TapeStation (High sensitivity RNA kit, Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... All point mutations were generated using the QuickChange lightning site-directed mutagenesis kit (Agilent). For protein expression in E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified on the bio-analyzer using DNA high-sensitivity kit (Agilent, 5067-4626). Barcoded libraries were sequenced on an Illumina NextSeq 500 with 38bp paired-end reads at a depth of about 25 million reads per plates.
-
bioRxiv - Molecular Biology 2024Quote: ... Library size distributions were confirmed using the High Sensitivity DNA Kit (Agilent #5067-4626) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality was evaluated using the Agilent DNA 1000 kit (Agilent, Cat# 5067-1504) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis to generate shfP mutants was achieved using the QuikChange kit (Agilent). All plasmids were integrated into the B ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked for quality with Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany). Only RNA samples with RNA integrity number (RIN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were cloned using a StrataClone Blunt PCR Cloning Kit (Agilent, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library concentrations were quantified using the Agilent High Sensitivity DNA kit (Agilent Technologies, USA). An equimolar pool consisting of 24 samples was prepared and sequenced on an NextSeq550 (single-read ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were analyzed using Agilent RNA 6000 Nano Kit and the Bioanalyzer system (Agilent). Thereby ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A library quality check was performed using the dsDNA 915 reagent kit (Agilent Technologies) and the Fragment Analyzer ...
-
bioRxiv - Immunology 2024Quote: ... Library QC was performed using the BioAnalyzer High Sensitivity DNA Kit (Agilent, #5067-4626) and run on the 2100 BioAnalyzer Instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... site directed mutagenesis was used (QuikChange II XL Site Directed Mutagenesis Kit, Agilent, 200521) as directed ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA quality was assessed using the RNA 6000 Nano kit total RNA assay (Agilent) run on the 2100 Bioanalyzer instrument (Agilent) ...
-
bioRxiv - Immunology 2024Quote: Extracellular flux assay was performed using Seahorse XF Cell Mito Stress Test Kit (Agilent). 24 hours prior to the assay ...
-
bioRxiv - Microbiology 2024Quote: ... The mutated SV40 enhancer sequences were created with QuickChange site-directed mutagenesis kit (Stratagene) or using InFusion site-directed mutagenesis ...
-
bioRxiv - Immunology 2024Quote: ... C188Y and Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 and K183S/K184S/*192C*24 plasmids were produced by ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutagenesis was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). 25 ng of dsDNA template vector was mixed with 0.5 µL dNTP mix ...
-
bioRxiv - Cell Biology 2024Quote: ... The staining was performed with the Dako LSAB2 System-HRP kit (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the Seahorse XF real-time ATP rate assay Kit (#103592-100, Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... After verification of library size distribution (∼325bp peak) using Bioanalyzer HS DNA Kit (Agilent), the library pool was subjected to RNA sequencing analysis using the MiSeq Micro V2 (2x150bp ...
-
bioRxiv - Microbiology 2022Quote: ... sgRNA quality control was performed on Qubit and Bioanalyzer RNA 6000 Pico Kit (Agilent).
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA synthesis was performed using Accuscript High-fidelity cDNA Synthesis Kit (Agilent technologies, USA) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). High-quality amplified RNAs were subject to library preparation (Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Library size distribution and concentration were measured using BioAnalyzer High Sensitivity DNA kit (Agilent) and NEB quantification kit ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... and a quality check using a bioanalyzer (Agilent High Sensitivity DNA Kit, #5067-4626). A small aliquot of the amplified cDNA was used for a qPCR testing while the remaining cDNA was kept at -20°C until further processing.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNA quality was confirmed by Bioanalyzer high sensitivity DNA kit (Agilent, Santa Clara). Sheared DNA was then adapter-ligated (AL ...
-
bioRxiv - Pathology 2023Quote: ... the reactions were detected/visualized using Envision FLEX+ High pH kit (Dako, GV800+ GV821) and Envision DAB+ Substrate Chromogen System (Dako ...
-
bioRxiv - Systems Biology 2022Quote: ... Library size distributions were determined using the High Sensitivity DNA Kit (Agilent #5067-4626), and sample concentrations were quantified using the Qubit dsDNA HS Assay Kit on a Qubit 4 Fluorometer ...
-
bioRxiv - Immunology 2023Quote: ... RNA concentration and integrity was determined by Bioanalyzer using RNA 6000 Pico Kit (Agilent). RNA-seq libraries were constructed using Illumina TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a 2100 BioAnalyzer with an Agilent RNA 6000 Pico Kit (#5067-1513, Agilent), DV200 ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The RNA quality was examined using the Bioanalyzer RNA 6000 pico kit (Agilent, USA).
-
bioRxiv - Genomics 2023Quote: ... we first used the QuikChange II Site-directed mutagenesis kit (Agilent, cat. no. #200523) according to the manufacturer’s instructions to remove the 78 bp mitochondrial localization signal (MLS ...
-
bioRxiv - Cell Biology 2023Quote: ... Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). All mutant constructs were verified by Sanger sequencing.