Labshake search
Citations for Agilent :
3101 - 3150 of 8383 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Point mutations were generated using the QuickChange II site-directed mutagenesis kit (Agilent, 200523) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The intact cellular oxygen consumption rate (OCR) assay kit was purchased from Seahorse Bioscience. Horseradish peroxidase (HRP)-conjugated ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning of pCAGGS-VP3026A29S was performed with the multi-site directed mutagenesis kit (Agilent) according to the manufacture’s recommendations ...
-
bioRxiv - Plant Biology 2019Quote: ... and quality was assessed with the Agilent 6000 Nano Kit (Agilent, Santa Clara, California). Strand-specific library construction and paired-end RNA sequencing were done by Novogene (Chula Vista ...
-
bioRxiv - Genetics 2021Quote: ... Mutations were made in the CREAX reporter using the Quickchange II Kit (Stratagene, 200518). Details of the mutations are shown in supplementary table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The VPS41 mutant variants were made using the QuickChange Site-Directed Mutagenesis kit (Agilent) using the primers 5’-CAGCTTGTTGTACTTCCGTATGTAAAGGAGA and 5’- TCTCCTTTACATACGGAAGTACAACAAGCTG to generate GFP-VPS41S285P and 5’- GTTTATCTTCTGAGCTGAATGGGTTAATAGCC and 5’-GGCTATTACCCATTCAGCTCAGAAGATAAAC to generate GFP-VPS41R662* ...
-
bioRxiv - Biochemistry 2020Quote: Mutants of StSOR were constructed with a QuikChange site-directed mutagenesis kit (Agilent Technologies) using the following and complementary oligonucleotides ...
-
bioRxiv - Biochemistry 2021Quote: ... This was corrected by site-directed mutagenesis (SDM) using the QuikChange Lightening kit (Agilent), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Cell Biology 2020Quote: ... and fragmented cDNA integrity was confirmed using the Agilent RNA 6000 Nano Kit (Agilent) and 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... We used the Fragment Analyzer dsDNA 920 Reagent Kit (Agilent Technologies, Santa Clara, CA) to perform the automated gel electrophoresis analysis ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutation A577I was introduced using QuikChange Lightning Site- Directed Mutagenesis Kit (Agilent Technologies). The constructs were cloned into a pET28b vector (Novagen ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced into bovine rhodopsin using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Point (Site) mutations of SOD2 were generated by QuikChange Site-Directed Mutagenesis kit (Stratagene). Both WT SOD2 and SOD2 mutant plasmids were transfected into ZF4 cells using Lipofectamine 3000 Transfection Reagent (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... or 229 (A229C) using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The mutated constructs were purified as described above ...
-
bioRxiv - Genomics 2021Quote: ... RNA integrity and quantity were finally measured using RNA Nano 6000 Assay Kit (Agilent) of the Bioanalyzer 2100 system ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PEAK3 A436E mutant was generated with the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The pCDNA3.1-V5-PTK2B (PYK2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were tested using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Samples with an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Microbiology 2019Quote: ... and TEXEL point mutations were accomplished similarly with Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Agilent Bioanalyzer with Agilent RNA 6000 Nano Kit (Agilent Technologies, Palo Alto, CA, USA) was used as per manufacturer’s guidelines to assess the integrity of RNA samples ...
-
bioRxiv - Immunology 2020Quote: ... and RNA integrity was evaluated with the Bioanalyzer RNA pico kit TapeStation (Agilent Technologies). Two hundred nanograms of total RNA was subsequently processed to generate RNA-seq libraries using NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA labeling was performed with the two color ‘Quick Amp Labeling Kit’ (Agilent genomics) using a 1:5 mixture of ‘FullSpectrum MultiStart Primer’ (Systembio) ...
-
bioRxiv - Immunology 2020Quote: ... We used the Seahorse XF Cell Mito Stress Test Kit (103015-100, Seahorse Bioscience) for the OCR assay ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was evaluated with an Agilent 2100 Bioanalyzer RNA pico kit (Agilent Technologies) prior to sequencing library preparation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and quantity and quality were verified using RNA 6000 Nano Kit (Agilent – 5067-1511) and an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genomics 2021Quote: ... Library quality and size were assessed using a Bioanalyzer High Sensitivity DNA kit (Agilent). Libraries were run on HiSeq 4000 and NovaSeq6000 in 150 bp × 2 paired-end mode (Illumina ® ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA library was constructed using the SureSelect Low Input library prep kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified using a BioAnalyser high sensitivity DNA kit (Agilent, Cat#5067-4626) and a Qubit high-sensitivity dsDNA kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA quality was assessed using an RNA 6000 Pico kit (Agilent, 5067-1513) on a Bioanalyzer (Agilent G2939A).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quality-accessed with an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) with RNA integrity number above 9 for library construction ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies) in a BioAnalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 at a read length of 38 bp.
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the sections were incubated in HRP rabbit/mouse secondary antibody (DAKO Real EnVision kit) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was performed to create the FLOT2 G2A and FLOT2 Y163F mutants ...
-
bioRxiv - Bioengineering 2022Quote: ... and site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent). The introduction of mutations was confirmed through sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations of LcTwinkle were generated using methods described in the QuikChange mutagenesis kit (Agilent). Sequences of the LcTwinkle constructs were confirmed by sequencing the entire reading frames of each construct ...
-
bioRxiv - Cancer Biology 2022Quote: ... and antigens were visualized with a DAKO Envision Kit (HRP/DAB System; Dako Cytomation).
-
bioRxiv - Cell Biology 2022Quote: ... HA-tagged DCX mutant T203R were created using QuikChange Site-Directed Mutagenesis kit (Stratagene). HA-tagged DCX mutant A71S was synthesized commercially (Genewiz ...
-
bioRxiv - Cell Biology 2022Quote: ... Amplified cDNA was cloned into pSC plasmid (StrataClone Blunt PCR Cloning Kit, STRATAGENE, 240207). Then ...
-
bioRxiv - Genetics 2022Quote: ... The SphI site was mutated to XhoI using a site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... and evaluated using an Agilent 2100 Bioanalyzer (5067-1513, Agilent RNA 6000 Pico Kit). After DNase I (M0303S ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... kit and also checked in the Agilent 2100 Bioanalyzer High Sensitivity DNA (Agilent Technologies). The libraries were run in the in-house Illumina NextSeq 500 using the 300-cycle mid-or high-output kit.