Labshake search
Citations for Agilent :
251 - 300 of 8452 citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Short-chain fatty acids were analyzed by gas chromatography with a flame ionization detector (GC-FID 7890 A Agilent Technologies Inc.) with a fused silica capillary column (Nukon SUPELCO ...
-
bioRxiv - Systems Biology 2023Quote: ... bile acids and short chain fatty acids analyses were performed by LC-MS/MS with a 1260 UHPLC (Ultra-High Performance Liquid Chromatography) (Agilent Technologies) coupled to a QQQ 6410 (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... variant hLPYK proteins were created by mutating the coding region of the pLC11 plasmid (originally a kind gift from Dr. Andrea Mattevi 28) using QuikChange (Stratagene) and primers designed to individually obtain all 19 substitutions at each position ...
-
bioRxiv - Cell Biology 2021Quote: RNAi-resistant EGFP-ORP5A and EGFP-ORP5B were generated by introducing 4 silent point mutations in the region targeted by the 2 siRNA oligos (#10 and #11) by site-directed mutagenesis (Quickchange II-XL, Stratagene) and the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Mutations in nsp7 and nsp8 coding region in pET21a constructs were introduced following the Quickchange site-directed mutagenesis protocol (Stratagene). All constructs were transformed into Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Systems Biology 2020Quote: Block 3-6s for the motif-rich core regions of our synthetic promoter constructs were amplified from a library synthesized by Agilent Technologies (LeProust et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Cancer Biology 2021Quote: Using Agilent Technologies’ custom CGH-array format we arrayed 932 out of 1092 regions from the chromatin accessibility signature (Agilent probes were not available to cover the remaining 160 regions) ...
-
bioRxiv - Genetics 2022Quote: ... A ∼400bp region around the expected Cas9 cut site in exon1 of EXOSC2 was amplified by PCR using PfuTurbo DNA polymerase (Agilent), according to the manufacturer’s instructions using primers ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... were introduced into the CXCR4-coding region of the CXCR4-rluc3 vector using the QuikChange site-directed mutagenesis method (Stratagene). The plasmid used to express renilla GFP (rGFP ...
-
bioRxiv - Microbiology 2020Quote: ... We produced the purified 16S V4 rDNA by amplification of the V4 region of Escherichia coli XL 10-gold (Agilent) using TaKaRa Taq R001 AM kit (Clonetech ...
-
bioRxiv - Microbiology 2021Quote: ... Results were confirmed by PCR amplification of the APOE gene region containing allele-differentiating SNPs rs429358 and rs7412 using PfuUltra II Fusion High-Fidelity DNA Polymerase (Agilent), followed by Sanger sequencing using the BigDye 3.1 Cycle Sequencing Kit on the 3130XL Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Hybrid capture of exonic regions was performed using Agilent SureSelect in-solution capture reagents and SureSelect XT Human All Exon V4 probes (Agilent). Captured libraries were sequenced using 100 bp paired-end runs on Illumina HiSeq 2500 ...
-
bioRxiv - Neuroscience 2023Quote: ... genes that did not demonstrate at least ≈40% present calls across all transcripts profiled for each region-specific comparison were removed by using Genespring GX 7.3 Expression Analysis software (Agilent Technologies). A two-tailed unpaired T-test ...
-
bioRxiv - Physiology 2023Quote: ... The molar concentration of cDNA molecules was calculated from the double stranded DNA concentration and the region average size (determined by analyzing each sample on an Agilent 2200 Tapestation instrument (cat#5067–5584 and cat#5067–5585 ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Epidemiology 2019Quote: ... OGTT plasma insulin concentrations were measured by ELISA (Dako UK Ltd., Ely, Cambs, U.K.). Intra-assay imprecision (CV ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Seahorse XF Glycolysis Stress Test Kit and Cell Mito Stress Test Kit (Agilent) were used to measuring cell glycolysis and mitochondrial function ...
-
bioRxiv - Biochemistry 2023Quote: ... An alanine mutant library of the SNAP-tagged human truncated mGlu5 receptor (mGlu5-Δ856, designated as WT in the following experiments) was generated using Quick-change strategy (Agilent technologies) and verified by sequencing (Eurofins Genomics)11 ...
-
bioRxiv - Systems Biology 2022Quote: ... washed in 1x TBS-T and blocked with Antibody Diluent (Agilent, USA). The slides were then incubated with primary antibody diluted in Normal Antibody Diluent ...
-
bioRxiv - Neuroscience 2021Quote: fMRI was performed using a 9.4 T Agilent horizontal bore scanner (Agilent) as described in detail previously20,21 ...
-
bioRxiv - Systems Biology 2023Quote: Sample preparation was automated on AssayMap BRAVO (Agilent T., Santa Clara, US) to reduce preanalytical variability ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody staining was performed in PBS-T with 1% blocking reagent (DAKO) using 1/200 anti-LIPA (MyBioSource ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were stained with HAstV mouse monoclonal antibody 8E7 (2 μg/ml DakoCytomation) for 1 hour at room temperature followed by anti-mouse IgG labeled with Alexa Fluor 488 (anti-mouse IgG-Alexa Fluor 488 ...
-
bioRxiv - Pathology 2023Quote: ... mouse IgG2a anti-mouse αSMA (Dako, M851), rabbit anti-mouse vimentin (Cell Signaling ...
-
bioRxiv - Physiology 2021Quote: ... sections were immunostained with alpha-smooth muscle actin (α-SMA) antibody (Clone 1A4, DAKO, M0851, Agilent Technologies, Santa Clara, CA, USA). Slides containing gastrocnemius muscle sections were deparaffinized in xylene and rehydrated using a graded ethanol series ...
-
bioRxiv - Neuroscience 2020Quote: ... The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent, #G4852A) and a DNA microarray scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... purified DNA from 27 mice with the Sureprint G3 mouse CGH 244K microarray kit (Agilent Technologies), as previously described11 ...
-
bioRxiv - Pathology 2024Quote: ... the sections were incubated with horseradish peroxidase (HRP) secondary mouse antibody (DAKO Envision kit cat# K4001) for 30 min and the staining was visualized using 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Immunology 2020Quote: ... Cytospots were stained by May-Gruenwald Giemsa stain and mast cells were detected immunohistochemically (monoclonal mouse anti-human mast cell tryptase, Dako). Staining protocols and further details can be found in the supplementary material ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were analyzed using either XF Cell Mito Stress Test Kit (Seahorse Bioscience) or XFp Glycolysis Stress Test Kit (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and XF Cell Mito Stress Test Kit (Seahorse Bioscience). Cells were seeded at 50,000 cells/well (~80-90% confluent when assayed ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell Mito Stress Test Kit (Agilent, 103015), was used for the assay ...
-
bioRxiv - Immunology 2022Quote: ... and Seahorse XF Cell Mito Stress Test Kit (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... Agilent seahorse XFp cell mito stress kit (Agilent Technologies) was utilized to carry out mitochondrial respiration assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... XF Cell Mito Stress Test kit (103015-100, Agilent) and Seahorse XF Mito Fuel Flex Test kit (103260-100 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... segetum to the synthetic mixture of C6-C10 straight chain acids were recorded on an Agilent 7890 gas chromatograph equipped with a flame ionization detector (FID) (Agilent Technologies, USA) and an electroantennographic detector (EAD ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length cDNAs of the zebrafish banp gene were amplified with Polymerase Chain Reaction (PCR) and sub-cloned into pBluescript II SK(+) vectors (Stratagene/Agilent Technologies). cDNA fragments were amplified from mRNA with PCR using the primers for cenpt ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Zoology 2020Quote: ... Positively immunostained regions showed a golden dark brown color using 3,3’-diaminobenzidine tetrahydrochloride (DAB) as chromogen and H2O2 reaction substrates (DakoCytomation, Glostrup, Denmark). All sections were counterstained with Maeyer’s hematoxylin.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Genomics 2021Quote: ... the sections were incubated with an anti-ESR1 antibody (FLEX Monoclonal Rabbit Anti-Human Estrogen Receptor α, Agilent technologies, Dako, Glostrup, Denmark) at a 1:2 dilution for 60 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... the sections were incubated with an anti-ESR1 antibody (FLEX Monoclonal Rabbit Anti-Human Estrogen Receptor α, Agilent technologies, Dako, Glostrup, Denmark) at a 1:2 dilution for 60 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were washed with TBS-T incubated with HRP-conjugated secondary antibodies (Dako). After washing in TBS-T again ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were incubated with blocking buffer (PBS-T with 10% Donkey Serum, Dako) for 30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... T2-weighted RARE images were acquired on a 7-T scanner (Varian/Agilent) with imaging parameters ...